ID: 926352344

View in Genome Browser
Species Human (GRCh38)
Location 2:12007577-12007599
Sequence ATGTGTTGAGGAACTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926352344_926352348 -2 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352348 2:12007598-12007620 ATTTTTTCATCTGTAAAATGGGG 0: 8
1: 218
2: 1458
3: 5006
4: 11176
926352344_926352349 30 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352349 2:12007630-12007652 AATAATAGTACCTACCTTAAAGG No data
926352344_926352346 -4 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352346 2:12007596-12007618 ACATTTTTTCATCTGTAAAATGG No data
926352344_926352347 -3 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352347 2:12007597-12007619 CATTTTTTCATCTGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926352344 Original CRISPR ATGTGTTGAGGAACTCAGCC TGG (reversed) Intergenic
No off target data available for this crispr