ID: 926352347

View in Genome Browser
Species Human (GRCh38)
Location 2:12007597-12007619
Sequence CATTTTTTCATCTGTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926352344_926352347 -3 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352347 2:12007597-12007619 CATTTTTTCATCTGTAAAATGGG No data
926352343_926352347 -2 Left 926352343 2:12007576-12007598 CCCAGGCTGAGTTCCTCAACACA No data
Right 926352347 2:12007597-12007619 CATTTTTTCATCTGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926352347 Original CRISPR CATTTTTTCATCTGTAAAAT GGG Intergenic
No off target data available for this crispr