ID: 926352349

View in Genome Browser
Species Human (GRCh38)
Location 2:12007630-12007652
Sequence AATAATAGTACCTACCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926352344_926352349 30 Left 926352344 2:12007577-12007599 CCAGGCTGAGTTCCTCAACACAT No data
Right 926352349 2:12007630-12007652 AATAATAGTACCTACCTTAAAGG No data
926352345_926352349 18 Left 926352345 2:12007589-12007611 CCTCAACACATTTTTTCATCTGT No data
Right 926352349 2:12007630-12007652 AATAATAGTACCTACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926352349 Original CRISPR AATAATAGTACCTACCTTAA AGG Intergenic
No off target data available for this crispr