ID: 926356257 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:12043399-12043421 |
Sequence | TCCCATAAAAGCATTGTGCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926356257_926356259 | 11 | Left | 926356257 | 2:12043399-12043421 | CCTTGCACAATGCTTTTATGGGA | No data | ||
Right | 926356259 | 2:12043433-12043455 | TCTTGATGGAAAACAAATATAGG | No data | ||||
926356257_926356258 | -3 | Left | 926356257 | 2:12043399-12043421 | CCTTGCACAATGCTTTTATGGGA | No data | ||
Right | 926356258 | 2:12043419-12043441 | GGAAAGATGATGCATCTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926356257 | Original CRISPR | TCCCATAAAAGCATTGTGCA AGG (reversed) | Intergenic | ||