ID: 926356257 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:12043399-12043421 |
| Sequence | TCCCATAAAAGCATTGTGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 926356257_926356259 | 11 | Left | 926356257 | 2:12043399-12043421 | CCTTGCACAATGCTTTTATGGGA | No data | ||
| Right | 926356259 | 2:12043433-12043455 | TCTTGATGGAAAACAAATATAGG | No data | ||||
| 926356257_926356258 | -3 | Left | 926356257 | 2:12043399-12043421 | CCTTGCACAATGCTTTTATGGGA | No data | ||
| Right | 926356258 | 2:12043419-12043441 | GGAAAGATGATGCATCTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 926356257 | Original CRISPR | TCCCATAAAAGCATTGTGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||