ID: 926356257

View in Genome Browser
Species Human (GRCh38)
Location 2:12043399-12043421
Sequence TCCCATAAAAGCATTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926356257_926356259 11 Left 926356257 2:12043399-12043421 CCTTGCACAATGCTTTTATGGGA No data
Right 926356259 2:12043433-12043455 TCTTGATGGAAAACAAATATAGG No data
926356257_926356258 -3 Left 926356257 2:12043399-12043421 CCTTGCACAATGCTTTTATGGGA No data
Right 926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926356257 Original CRISPR TCCCATAAAAGCATTGTGCA AGG (reversed) Intergenic