ID: 926356474

View in Genome Browser
Species Human (GRCh38)
Location 2:12045273-12045295
Sequence GCTCCTAGTGGCCCATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926356466_926356474 28 Left 926356466 2:12045222-12045244 CCAGGGCTTTGGAATCTTCAGGT No data
Right 926356474 2:12045273-12045295 GCTCCTAGTGGCCCATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926356474 Original CRISPR GCTCCTAGTGGCCCATAATC TGG Intergenic
No off target data available for this crispr