ID: 926360929

View in Genome Browser
Species Human (GRCh38)
Location 2:12086069-12086091
Sequence CTGTGAGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926360923_926360929 11 Left 926360923 2:12086035-12086057 CCAGACACAGTAGCTCATGTCTG No data
Right 926360929 2:12086069-12086091 CTGTGAGAGGCCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926360929 Original CRISPR CTGTGAGAGGCCAAGGTGGA TGG Intergenic
No off target data available for this crispr