ID: 926361902

View in Genome Browser
Species Human (GRCh38)
Location 2:12096560-12096582
Sequence CTGTCTCAGCTATGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926361902_926361906 3 Left 926361902 2:12096560-12096582 CCAGAGCCCCATAGCTGAGACAG No data
Right 926361906 2:12096586-12096608 CAGCATTTAACCCAGCTGTGAGG No data
926361902_926361909 24 Left 926361902 2:12096560-12096582 CCAGAGCCCCATAGCTGAGACAG No data
Right 926361909 2:12096607-12096629 GGATCAGTGAAGATTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926361902 Original CRISPR CTGTCTCAGCTATGGGGCTC TGG (reversed) Intergenic
No off target data available for this crispr