ID: 926363220

View in Genome Browser
Species Human (GRCh38)
Location 2:12109798-12109820
Sequence CCTTATACAAAGGTGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926363220_926363224 -4 Left 926363220 2:12109798-12109820 CCAAATTCCACCTTTGTATAAGG No data
Right 926363224 2:12109817-12109839 AAGGACACCAGTCCCATAGATGG No data
926363220_926363227 3 Left 926363220 2:12109798-12109820 CCAAATTCCACCTTTGTATAAGG No data
Right 926363227 2:12109824-12109846 CCAGTCCCATAGATGGGATGAGG No data
926363220_926363225 -3 Left 926363220 2:12109798-12109820 CCAAATTCCACCTTTGTATAAGG No data
Right 926363225 2:12109818-12109840 AGGACACCAGTCCCATAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926363220 Original CRISPR CCTTATACAAAGGTGGAATT TGG (reversed) Intergenic
No off target data available for this crispr