ID: 926363651

View in Genome Browser
Species Human (GRCh38)
Location 2:12113502-12113524
Sequence CAGCCATGGTTGGCTGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926363646_926363651 13 Left 926363646 2:12113466-12113488 CCTGGCAAACATTCTCACTTCTG No data
Right 926363651 2:12113502-12113524 CAGCCATGGTTGGCTGCTTTTGG No data
926363645_926363651 24 Left 926363645 2:12113455-12113477 CCTTGGGAGCACCTGGCAAACAT No data
Right 926363651 2:12113502-12113524 CAGCCATGGTTGGCTGCTTTTGG No data
926363643_926363651 29 Left 926363643 2:12113450-12113472 CCTGCCCTTGGGAGCACCTGGCA No data
Right 926363651 2:12113502-12113524 CAGCCATGGTTGGCTGCTTTTGG No data
926363644_926363651 25 Left 926363644 2:12113454-12113476 CCCTTGGGAGCACCTGGCAAACA No data
Right 926363651 2:12113502-12113524 CAGCCATGGTTGGCTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926363651 Original CRISPR CAGCCATGGTTGGCTGCTTT TGG Intergenic
No off target data available for this crispr