ID: 926368390

View in Genome Browser
Species Human (GRCh38)
Location 2:12154941-12154963
Sequence GTGTCCTAATAGGTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926368383_926368390 27 Left 926368383 2:12154891-12154913 CCTGCTGCTCCACATCTTTCCTC No data
Right 926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG No data
926368384_926368390 18 Left 926368384 2:12154900-12154922 CCACATCTTTCCTCTTGTTGCTG No data
Right 926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG No data
926368385_926368390 8 Left 926368385 2:12154910-12154932 CCTCTTGTTGCTGTCAGTGTTTT No data
Right 926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926368390 Original CRISPR GTGTCCTAATAGGTGTGTTG TGG Intergenic
No off target data available for this crispr