ID: 926369839

View in Genome Browser
Species Human (GRCh38)
Location 2:12168663-12168685
Sequence CAGGGGGCCCAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926369830_926369839 26 Left 926369830 2:12168614-12168636 CCACTTCACGTGGTCTCTGGGAA No data
Right 926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG No data
926369834_926369839 -5 Left 926369834 2:12168645-12168667 CCGAAGGAAAGAAGGCCACAGGG No data
Right 926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926369839 Original CRISPR CAGGGGGCCCAGAGAGAAGA AGG Intergenic
No off target data available for this crispr