ID: 926372580

View in Genome Browser
Species Human (GRCh38)
Location 2:12194953-12194975
Sequence ATCCCCTTTGTTAAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926372580_926372586 8 Left 926372580 2:12194953-12194975 CCACTGACTTTAACAAAGGGGAT No data
Right 926372586 2:12194984-12195006 TGGAGCAGGGTTGAATTGTTTGG No data
926372580_926372587 11 Left 926372580 2:12194953-12194975 CCACTGACTTTAACAAAGGGGAT No data
Right 926372587 2:12194987-12195009 AGCAGGGTTGAATTGTTTGGTGG No data
926372580_926372582 -6 Left 926372580 2:12194953-12194975 CCACTGACTTTAACAAAGGGGAT No data
Right 926372582 2:12194970-12194992 GGGGATTTCCCAGATGGAGCAGG No data
926372580_926372583 -5 Left 926372580 2:12194953-12194975 CCACTGACTTTAACAAAGGGGAT No data
Right 926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926372580 Original CRISPR ATCCCCTTTGTTAAAGTCAG TGG (reversed) Intergenic
No off target data available for this crispr