ID: 926372583

View in Genome Browser
Species Human (GRCh38)
Location 2:12194971-12194993
Sequence GGGATTTCCCAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926372580_926372583 -5 Left 926372580 2:12194953-12194975 CCACTGACTTTAACAAAGGGGAT No data
Right 926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926372583 Original CRISPR GGGATTTCCCAGATGGAGCA GGG Intergenic
No off target data available for this crispr