ID: 926377472

View in Genome Browser
Species Human (GRCh38)
Location 2:12248077-12248099
Sequence ATCTGTAAGTTAAAGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926377472_926377477 16 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377477 2:12248116-12248138 TAACTGTCAGGTGGAGGATCAGG No data
926377472_926377476 10 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377476 2:12248110-12248132 TTCAAATAACTGTCAGGTGGAGG No data
926377472_926377479 22 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377479 2:12248122-12248144 TCAGGTGGAGGATCAGGAGGAGG No data
926377472_926377475 7 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377475 2:12248107-12248129 ACATTCAAATAACTGTCAGGTGG No data
926377472_926377474 4 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377474 2:12248104-12248126 ATCACATTCAAATAACTGTCAGG No data
926377472_926377478 19 Left 926377472 2:12248077-12248099 CCAACCATCTTTAACTTACAGAT No data
Right 926377478 2:12248119-12248141 CTGTCAGGTGGAGGATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926377472 Original CRISPR ATCTGTAAGTTAAAGATGGT TGG (reversed) Intergenic
No off target data available for this crispr