ID: 926377982

View in Genome Browser
Species Human (GRCh38)
Location 2:12253072-12253094
Sequence TCTTCATGATGCACTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926377982_926377985 21 Left 926377982 2:12253072-12253094 CCAGCAGGAGTGCATCATGAAGA No data
Right 926377985 2:12253116-12253138 TTTCCTGTTCTTCCCGTTCTCGG No data
926377982_926377988 25 Left 926377982 2:12253072-12253094 CCAGCAGGAGTGCATCATGAAGA No data
Right 926377988 2:12253120-12253142 CTGTTCTTCCCGTTCTCGGTGGG No data
926377982_926377987 24 Left 926377982 2:12253072-12253094 CCAGCAGGAGTGCATCATGAAGA No data
Right 926377987 2:12253119-12253141 CCTGTTCTTCCCGTTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926377982 Original CRISPR TCTTCATGATGCACTCCTGC TGG (reversed) Intergenic