ID: 926379813

View in Genome Browser
Species Human (GRCh38)
Location 2:12275729-12275751
Sequence GTGGATTAGAAAGTCAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926379809_926379813 14 Left 926379809 2:12275692-12275714 CCACTGACAGCAAAAGAAGAGTG No data
Right 926379813 2:12275729-12275751 GTGGATTAGAAAGTCAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926379813 Original CRISPR GTGGATTAGAAAGTCAACTC TGG Intergenic
No off target data available for this crispr