ID: 926381819

View in Genome Browser
Species Human (GRCh38)
Location 2:12298553-12298575
Sequence GTCCATAGAAGTGGATGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926381819_926381821 -1 Left 926381819 2:12298553-12298575 CCTGATCATCCACTTCTATGGAC No data
Right 926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926381819 Original CRISPR GTCCATAGAAGTGGATGATC AGG (reversed) Intergenic
No off target data available for this crispr