ID: 926381820

View in Genome Browser
Species Human (GRCh38)
Location 2:12298562-12298584
Sequence CACTCTAGAGTCCATAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926381820_926381821 -10 Left 926381820 2:12298562-12298584 CCACTTCTATGGACTCTAGAGTG No data
Right 926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926381820 Original CRISPR CACTCTAGAGTCCATAGAAG TGG (reversed) Intergenic
No off target data available for this crispr