ID: 926381821

View in Genome Browser
Species Human (GRCh38)
Location 2:12298575-12298597
Sequence CTCTAGAGTGATGTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926381820_926381821 -10 Left 926381820 2:12298562-12298584 CCACTTCTATGGACTCTAGAGTG No data
Right 926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG No data
926381819_926381821 -1 Left 926381819 2:12298553-12298575 CCTGATCATCCACTTCTATGGAC No data
Right 926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926381821 Original CRISPR CTCTAGAGTGATGTTTTTGT TGG Intergenic
No off target data available for this crispr