ID: 926383939

View in Genome Browser
Species Human (GRCh38)
Location 2:12317507-12317529
Sequence CCTCACACCCACACTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926383939_926383942 21 Left 926383939 2:12317507-12317529 CCAGAAGCAGTGTGGGTGTGAGG No data
Right 926383942 2:12317551-12317573 AGAACACATGCTATCAGCAAAGG No data
926383939_926383941 -7 Left 926383939 2:12317507-12317529 CCAGAAGCAGTGTGGGTGTGAGG No data
Right 926383941 2:12317523-12317545 TGTGAGGTCAGATATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926383939 Original CRISPR CCTCACACCCACACTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr