ID: 926383942

View in Genome Browser
Species Human (GRCh38)
Location 2:12317551-12317573
Sequence AGAACACATGCTATCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926383935_926383942 30 Left 926383935 2:12317498-12317520 CCCAGCAGGCCAGAAGCAGTGTG No data
Right 926383942 2:12317551-12317573 AGAACACATGCTATCAGCAAAGG No data
926383939_926383942 21 Left 926383939 2:12317507-12317529 CCAGAAGCAGTGTGGGTGTGAGG No data
Right 926383942 2:12317551-12317573 AGAACACATGCTATCAGCAAAGG No data
926383936_926383942 29 Left 926383936 2:12317499-12317521 CCAGCAGGCCAGAAGCAGTGTGG No data
Right 926383942 2:12317551-12317573 AGAACACATGCTATCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926383942 Original CRISPR AGAACACATGCTATCAGCAA AGG Intergenic
No off target data available for this crispr