ID: 926386429

View in Genome Browser
Species Human (GRCh38)
Location 2:12339973-12339995
Sequence GGTAATGTATGTAGACCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926386426_926386429 7 Left 926386426 2:12339943-12339965 CCTTACCTTGCTAATTGTATATT No data
Right 926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG No data
926386425_926386429 8 Left 926386425 2:12339942-12339964 CCCTTACCTTGCTAATTGTATAT No data
Right 926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG No data
926386427_926386429 2 Left 926386427 2:12339948-12339970 CCTTGCTAATTGTATATTAAATT No data
Right 926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926386429 Original CRISPR GGTAATGTATGTAGACCACT AGG Intergenic
No off target data available for this crispr