ID: 926390788

View in Genome Browser
Species Human (GRCh38)
Location 2:12390462-12390484
Sequence AAACTCAGAATTTCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926390788_926390789 -10 Left 926390788 2:12390462-12390484 CCAGTTTTGGAAATTCTGAGTTT No data
Right 926390789 2:12390475-12390497 TTCTGAGTTTGAGAAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926390788 Original CRISPR AAACTCAGAATTTCCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr