ID: 926395934

View in Genome Browser
Species Human (GRCh38)
Location 2:12442296-12442318
Sequence GGCCCTGTATAAGTCAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926395934_926395941 26 Left 926395934 2:12442296-12442318 CCTGAATTGACTTATACAGGGCC No data
Right 926395941 2:12442345-12442367 GCCTTTACTTTTGCTCGCAGAGG No data
926395934_926395936 -4 Left 926395934 2:12442296-12442318 CCTGAATTGACTTATACAGGGCC No data
Right 926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926395934 Original CRISPR GGCCCTGTATAAGTCAATTC AGG (reversed) Intergenic
No off target data available for this crispr