ID: 926396226

View in Genome Browser
Species Human (GRCh38)
Location 2:12445566-12445588
Sequence TGGTCACAAGATGCATCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926396224_926396226 -4 Left 926396224 2:12445547-12445569 CCAATGACTCCTGCTTAGGTGGT No data
Right 926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG No data
926396221_926396226 -2 Left 926396221 2:12445545-12445567 CCCCAATGACTCCTGCTTAGGTG No data
Right 926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG No data
926396222_926396226 -3 Left 926396222 2:12445546-12445568 CCCAATGACTCCTGCTTAGGTGG No data
Right 926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926396226 Original CRISPR TGGTCACAAGATGCATCTTC CGG Intergenic
No off target data available for this crispr