ID: 926397014

View in Genome Browser
Species Human (GRCh38)
Location 2:12453917-12453939
Sequence CCTCCCCGAGGCTCCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926397014_926397029 4 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397029 2:12453944-12453966 CCGGCGGGGGGGCCTCGGGGAGG No data
926397014_926397026 1 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397026 2:12453941-12453963 GTCCCGGCGGGGGGGCCTCGGGG No data
926397014_926397023 -7 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397023 2:12453933-12453955 GGGGAGGTGTCCCGGCGGGGGGG No data
926397014_926397021 -9 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397021 2:12453931-12453953 TCGGGGAGGTGTCCCGGCGGGGG No data
926397014_926397024 -1 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397024 2:12453939-12453961 GTGTCCCGGCGGGGGGGCCTCGG No data
926397014_926397022 -8 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397022 2:12453932-12453954 CGGGGAGGTGTCCCGGCGGGGGG No data
926397014_926397020 -10 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397020 2:12453930-12453952 CTCGGGGAGGTGTCCCGGCGGGG No data
926397014_926397025 0 Left 926397014 2:12453917-12453939 CCGGCGGGGGAGCCTCGGGGAGG No data
Right 926397025 2:12453940-12453962 TGTCCCGGCGGGGGGGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926397014 Original CRISPR CCTCCCCGAGGCTCCCCCGC CGG (reversed) Intergenic