ID: 926398273

View in Genome Browser
Species Human (GRCh38)
Location 2:12468174-12468196
Sequence CCTTCTATCCAGAAGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926398269_926398273 20 Left 926398269 2:12468131-12468153 CCTTTACAGAACAAAGACTGAAT No data
Right 926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926398273 Original CRISPR CCTTCTATCCAGAAGGTGCT AGG Intergenic
No off target data available for this crispr