ID: 926401263

View in Genome Browser
Species Human (GRCh38)
Location 2:12499560-12499582
Sequence CTGGAGAGCTGGGATTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926401263_926401268 4 Left 926401263 2:12499560-12499582 CCTTCATAATCCCAGCTCTCCAG No data
Right 926401268 2:12499587-12499609 ATGGATTAATTTTTCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926401263 Original CRISPR CTGGAGAGCTGGGATTATGA AGG (reversed) Intergenic
No off target data available for this crispr