ID: 926401447

View in Genome Browser
Species Human (GRCh38)
Location 2:12501129-12501151
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926401447_926401448 17 Left 926401447 2:12501129-12501151 CCACTTTAGATGTGATGAACAAG No data
Right 926401448 2:12501169-12501191 ATGCTGTGTTCCAATAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926401447 Original CRISPR CTTGTTCATCACATCTAAAG TGG (reversed) Intergenic
No off target data available for this crispr