ID: 926405801

View in Genome Browser
Species Human (GRCh38)
Location 2:12551506-12551528
Sequence GAACCCTGGGCTGCAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926405790_926405801 13 Left 926405790 2:12551470-12551492 CCTGGCGCCACCTCCCCAGCCCT No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405794_926405801 -1 Left 926405794 2:12551484-12551506 CCCAGCCCTTCCTTCACATCTAG No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405797_926405801 -7 Left 926405797 2:12551490-12551512 CCTTCCTTCACATCTAGAACCCT No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405789_926405801 16 Left 926405789 2:12551467-12551489 CCACCTGGCGCCACCTCCCCAGC No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405791_926405801 6 Left 926405791 2:12551477-12551499 CCACCTCCCCAGCCCTTCCTTCA No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405792_926405801 3 Left 926405792 2:12551480-12551502 CCTCCCCAGCCCTTCCTTCACAT No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405788_926405801 17 Left 926405788 2:12551466-12551488 CCCACCTGGCGCCACCTCCCCAG No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405795_926405801 -2 Left 926405795 2:12551485-12551507 CCAGCCCTTCCTTCACATCTAGA No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405796_926405801 -6 Left 926405796 2:12551489-12551511 CCCTTCCTTCACATCTAGAACCC No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data
926405793_926405801 0 Left 926405793 2:12551483-12551505 CCCCAGCCCTTCCTTCACATCTA No data
Right 926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926405801 Original CRISPR GAACCCTGGGCTGCAACCAC AGG Intergenic
No off target data available for this crispr