ID: 926408402

View in Genome Browser
Species Human (GRCh38)
Location 2:12577084-12577106
Sequence TCCTGCTGGACTGCAGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926408402 Original CRISPR TCCTGCTGGACTGCAGCTTG AGG (reversed) Intergenic
900957834 1:5898467-5898489 TCCTACTGAACTGAAGCTTCCGG - Intronic
902640821 1:17765064-17765086 TGCTGCTGGAATCCAGCTTGTGG + Intronic
903891804 1:26574768-26574790 TCCTGCTGGCTTCCAGCTTCAGG + Intronic
904058112 1:27685725-27685747 TCCTGATGAGCTGCAGCTGGTGG + Intergenic
904668712 1:32145364-32145386 TGCTGCTGCACTCCAGCTTGGGG - Intronic
906062417 1:42957812-42957834 TCCCGCTAGACTTCAGCCTGGGG + Intronic
906152208 1:43594125-43594147 ACCTGCTGTGCTGCAGCTGGGGG - Intronic
906302417 1:44692772-44692794 TGCTGCTGTACTCCAGCCTGGGG - Intronic
906433768 1:45777661-45777683 TGCTGCTGTACTCCAGCCTGGGG - Intergenic
907516871 1:54998382-54998404 TACTTCTTAACTGCAGCTTGAGG - Intergenic
908636657 1:66174121-66174143 TCCTGCTGAACTACAGCTAATGG + Intronic
908756189 1:67470871-67470893 TGCTGCTGCTCTCCAGCTTGGGG - Intergenic
909268283 1:73590506-73590528 ACCTGCTGGACTGCATTTTCAGG - Intergenic
909413532 1:75380174-75380196 TACTGCTGCACTGCCGCTTGTGG - Intronic
911664613 1:100539143-100539165 TGCTGGTGGTCTGCAGCTTTCGG - Exonic
912785141 1:112595460-112595482 CACTGCTGCACTGCAGCCTGAGG - Intronic
912822942 1:112882179-112882201 TCCAGCAGGACTGCACATTGGGG + Intergenic
913294896 1:117309902-117309924 TTCTGCTGGGCTGCAGGATGGGG - Intergenic
913314749 1:117540345-117540367 TCCTGTTGGACTGGAGTCTGGGG + Intergenic
915402356 1:155632735-155632757 TACTGCTGCACTGCCGCTTGTGG + Intergenic
915607751 1:156963924-156963946 TCCTGCTGGACTGCTGGGTTGGG + Intronic
915914807 1:159934525-159934547 TCCTGGTGGACGGGAGCCTGCGG - Exonic
916009751 1:160693930-160693952 TACTGCTGCACTGCCACTTGTGG - Intronic
916512090 1:165481607-165481629 TGCAGCTGGAGTGCAGCTGGAGG - Intergenic
917656423 1:177130672-177130694 CCCTGATGAACTGCAACTTGGGG - Intronic
918053051 1:180991260-180991282 TCCAGCTGGACTGAAGCTCTGGG - Intronic
918248377 1:182680438-182680460 TCGTCCTGAAGTGCAGCTTGAGG - Intronic
919753207 1:201051092-201051114 TCCTACTGGCCTGCAGCTATGGG - Exonic
920147098 1:203871573-203871595 TCCTGCTCTACTGGAGCCTGTGG + Intergenic
921170642 1:212545158-212545180 TGCCACTGCACTGCAGCTTGTGG + Intergenic
922349184 1:224721915-224721937 TCCTGCAGCCCTGCAGCTGGTGG - Intronic
922703107 1:227773744-227773766 CCATGCAGGCCTGCAGCTTGGGG + Intronic
923820839 1:237439142-237439164 TCATGCTGTACTTCAGCTTACGG + Intronic
923863205 1:237913387-237913409 TCCTGCTGGGTTACACCTTGGGG + Intergenic
1062828466 10:588699-588721 GCCTGCGGGACGGCAGCTGGAGG - Intronic
1063530907 10:6830531-6830553 TACTGCTGCACTGCCACTTGTGG + Intergenic
1064124824 10:12650682-12650704 TCCAGCTGCGCTGCAGATTGGGG - Intronic
1064144320 10:12815580-12815602 ACCTGCTGCACTGCAGGGTGCGG - Intronic
1065635113 10:27724300-27724322 AACTGCTGGACTGCAGATAGGGG - Intronic
1067224624 10:44367578-44367600 CCCTACTGGTCTGCAGCCTGGGG - Intergenic
1070442768 10:76463072-76463094 TTTTGCTAGACTGCAGCTTCAGG + Intronic
1070953149 10:80446791-80446813 TCCTGCTGTCCTCCAGTTTGGGG + Intergenic
1072780131 10:98244759-98244781 TCCAGCTGCACTGCAGCCAGGGG + Exonic
1072947752 10:99825817-99825839 TACTGCTGCACTGCCGCTCGTGG + Intronic
1075012981 10:118890799-118890821 TTCTGATGCACTGCAGCTAGAGG + Intergenic
1075206823 10:120456248-120456270 TCCTGCTGGGCTCCAGCTGGAGG + Intergenic
1076424883 10:130360876-130360898 TCCTGCTGGGCAGCAGCTGCGGG - Intergenic
1076871292 10:133196271-133196293 CCCTGCTGGACTCAAGCTTTGGG + Intronic
1079665263 11:23096611-23096633 TGCTACTGCACTCCAGCTTGGGG + Intergenic
1080562660 11:33478213-33478235 TGCTGCAGGACTGCAGGTGGTGG - Intergenic
1081978961 11:47254355-47254377 CCCTGCTGGGCTGGAGCTTCTGG + Intronic
1083394368 11:62379701-62379723 TACTGCTACACTGCCGCTTGTGG + Intronic
1084225007 11:67710557-67710579 GCCTGCTGGCGTGCAGCTGGGGG + Intergenic
1084262828 11:67990400-67990422 GCCTGCTGGGGTGCAGCTGGGGG + Intergenic
1084758902 11:71256042-71256064 TCCTGCTGCACTGGAGCGGGAGG + Intergenic
1084810565 11:71608705-71608727 GCCTGCTGGGGTGCAGCTGGGGG - Intergenic
1087042304 11:93813757-93813779 TGCTGCTGCACTCCAGCCTGGGG - Exonic
1087724074 11:101698151-101698173 TACTGCTGCACTGCCGCTTGTGG - Intronic
1088869138 11:113876365-113876387 TGCGGCTGCACTCCAGCTTGAGG - Intergenic
1089150960 11:116363904-116363926 TGCTGTTGCACTCCAGCTTGGGG - Intergenic
1089178040 11:116562297-116562319 TCCTGCCAATCTGCAGCTTGGGG - Intergenic
1089471765 11:118727069-118727091 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1089562784 11:119353382-119353404 TCCTGTTTGCCTGCGGCTTGGGG + Intergenic
1090003779 11:122983052-122983074 TCCTGGTGCACTGTAGTTTGGGG - Intergenic
1090965286 11:131592792-131592814 ACCTGGGGGACTGCAGCTTGGGG - Intronic
1091746340 12:2995284-2995306 ACCTGCTGGGGTACAGCTTGTGG - Intronic
1091844956 12:3648673-3648695 ACCTGCTGGTCTCCAGCATGAGG - Intronic
1094426598 12:30322752-30322774 TCCTGCAGGATGGCAGCTGGTGG - Intergenic
1095989914 12:48027488-48027510 GACTGCTGGACTGTAGCCTGGGG - Intergenic
1097331108 12:58333805-58333827 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1098092277 12:66916283-66916305 TCCTGCTGTACTCCAGCCTCAGG - Intergenic
1100331747 12:93589171-93589193 TCCAGCTAGACTGCAGATTCTGG + Intergenic
1101538396 12:105641804-105641826 TCCTTCTGGACTTCTGGTTGCGG - Intergenic
1102238634 12:111310167-111310189 CCCTGCTGGGCCCCAGCTTGGGG + Exonic
1102704128 12:114866637-114866659 TCCTGGTGGCATGCAGCCTGAGG + Intergenic
1103979291 12:124726170-124726192 TCCTGCTGGACTCAGGCCTGGGG - Intergenic
1105303187 13:19152919-19152941 TCCAGATGGACTGCAGCTCTGGG + Intergenic
1105978015 13:25490396-25490418 TCCTGGAGGACAGCAGCTTCAGG - Intronic
1106230001 13:27814386-27814408 TCTAGCTGGATAGCAGCTTGCGG + Intergenic
1107209352 13:37834767-37834789 TGCTGCTGCACTCCAGCCTGGGG - Intronic
1109147503 13:58799198-58799220 TGCTACTGCACTCCAGCTTGGGG - Intergenic
1111870495 13:93825900-93825922 TACTGCTGCACTTCAGCCTGGGG - Intronic
1111918419 13:94385328-94385350 TACTGCTAGACTGCAGGTTTAGG + Intronic
1112458750 13:99584583-99584605 TCCTGCAATACTGCAGCTGGTGG - Intergenic
1113096665 13:106672553-106672575 TCCTGCTTGACTGAAATTTGGGG + Intergenic
1113415178 13:110123441-110123463 TCCTGCTGGGCTCCAGCCCGAGG - Intergenic
1114004404 14:18296482-18296504 CACTGCTGGACTGCAGCCTGGGG + Intergenic
1114495368 14:23128131-23128153 TCCTGCTGGTCTTCAGCCTGTGG - Exonic
1115061199 14:29192327-29192349 TCTTGCTGGCCTTCAGCTGGGGG - Intergenic
1115474262 14:33799101-33799123 CCCTGCTGCACTCCAGCCTGAGG + Intronic
1116209875 14:41923456-41923478 TGCTTCTGGAATGCAACTTGTGG - Intergenic
1117342547 14:54804585-54804607 TCCAGCTGGGCTGCAACCTGTGG + Intergenic
1117413049 14:55468106-55468128 TCCTGCTGGCCTGCAGATCCTGG + Intergenic
1119960882 14:78855120-78855142 CGCTGCTGCACTCCAGCTTGGGG + Intronic
1120415665 14:84215546-84215568 AACTGCTGGTCTGCAGCCTGGGG + Intergenic
1120709074 14:87774287-87774309 TCCAGCGGGACAGCAGTTTGGGG + Intergenic
1121880838 14:97499094-97499116 ACCTGCTGGAGTGAAGCTTTTGG + Intergenic
1122206751 14:100151486-100151508 ACCTGCTGGACTGCAGCACGTGG + Intronic
1122822717 14:104355247-104355269 CCAAGCTGGAGTGCAGCTTGCGG - Intergenic
1123388866 15:19848730-19848752 CACTGCTGGACTGCAGCCTGGGG + Intergenic
1124991105 15:34674652-34674674 CCCTGCTACACTGCAGCTTCAGG + Intergenic
1125417518 15:39468806-39468828 TCCTGATGGAATGGAGATTGGGG - Intergenic
1127127382 15:55825051-55825073 TCTTGCTGGATGGCAGCTGGGGG - Intergenic
1128642045 15:69346661-69346683 TGCTACTGTACTTCAGCTTGGGG - Intronic
1130688545 15:86060371-86060393 TGCTGCTGCACTCCAGCCTGGGG - Intergenic
1131454924 15:92576078-92576100 TCCAGCTGGAGTGCAGGATGGGG + Intergenic
1132638456 16:965752-965774 TCCTGCTGGGCCGCACCTCGGGG + Intronic
1133716839 16:8458102-8458124 TCCTGCTGAGCTGCAGCTCTGGG - Intergenic
1134038585 16:11050761-11050783 TCCTGCTGGACGGCAGGTGCTGG - Intronic
1135781470 16:25305714-25305736 TGCTGCTGGAGTGTAGTTTGAGG - Intergenic
1139592742 16:67942578-67942600 TCCTGCTGGCCTGCAGCGGGTGG + Exonic
1140048210 16:71456644-71456666 ACCTGCTGGACTGGAACTTGTGG - Intronic
1142570629 17:871444-871466 TGCTGCTGCACTCCAGCCTGGGG - Intronic
1142640517 17:1283075-1283097 TCCTGCCGGACTGGAGGTTCTGG - Intronic
1143020356 17:3914387-3914409 CCCGGCTGGGCAGCAGCTTGGGG + Intronic
1143370637 17:6436816-6436838 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
1145415018 17:22707808-22707830 TCCTGCTTAACAGCAGCATGAGG - Intergenic
1145789918 17:27620032-27620054 TTCTCCTCAACTGCAGCTTGGGG - Intronic
1146792013 17:35756413-35756435 TTCTGCTTTACTGCAGCCTGAGG - Intronic
1146900410 17:36582086-36582108 TCAGGCTGGTCTCCAGCTTGTGG + Intronic
1147187208 17:38719523-38719545 ACCTGGAGGACTGCAGCTTCCGG + Exonic
1149519814 17:57310199-57310221 TGCTGCTGGAGTGGACCTTGGGG + Intronic
1151341351 17:73473055-73473077 TACAGCTGCACTGCAGCTTTTGG + Intronic
1151582911 17:74990267-74990289 CCCTGCTGGTCTGCAGCTGTTGG + Intronic
1152779254 17:82219169-82219191 TCCTCCTCTTCTGCAGCTTGGGG - Intergenic
1153041151 18:813330-813352 TCCTCATGGACTGAACCTTGAGG + Intergenic
1155650478 18:28134667-28134689 TACCACTGCACTGCAGCTTGGGG + Intronic
1160353545 18:78206625-78206647 TCCAGCTGCACTGACGCTTGGGG + Intergenic
1163559484 19:18010314-18010336 TCCTGCTGGACTGGAGGCTGGGG + Exonic
1163920044 19:20279762-20279784 TACTGCTGCACTGCCACTTGTGG - Intergenic
1164150566 19:22546849-22546871 TCCTGGTAGACTGTAGGTTGCGG - Intergenic
1164154021 19:22578013-22578035 TACTGCTGCACTGTTGCTTGTGG - Intergenic
1164371001 19:27644311-27644333 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1165606820 19:37112956-37112978 TACTGCTGCACTGCCGCTTGTGG + Intronic
1166123870 19:40702215-40702237 CCCTTCTGCACTGCAGGTTGTGG - Intronic
1168226322 19:54997798-54997820 TGCTGCTGGACTCCAGCCTGGGG - Intronic
1168638208 19:58012735-58012757 TGCTGCTGTTCTGCAGCTTCTGG - Intergenic
925020162 2:562679-562701 CCCTGCGGGGCTGCAGCATGGGG + Intergenic
925020175 2:562725-562747 CCCTGCGGGGCTGCAGCATGGGG + Intergenic
925289832 2:2740133-2740155 TCCTGCTGGACTGAAGAAAGAGG + Intergenic
926408402 2:12577084-12577106 TCCTGCTGGACTGCAGCTTGAGG - Intergenic
929797104 2:45068595-45068617 TCCTGCTGTGCTGAGGCTTGCGG + Intergenic
931082114 2:58785327-58785349 TCCTACTGCACTGCAACTGGGGG - Intergenic
933282355 2:80345944-80345966 TCATGGTGGCCTGCAGATTGAGG + Intronic
933548488 2:83743738-83743760 TTCTGCTGGGCTGCAGCTACTGG + Intergenic
933993405 2:87649832-87649854 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
935134453 2:100287627-100287649 GGCTGATGGACTCCAGCTTGTGG + Intronic
935595525 2:104874322-104874344 TCCAGAGGGACTGGAGCTTGAGG + Intergenic
936300454 2:111301051-111301073 TGCTGCTGCACTCCAGCCTGGGG - Intergenic
937091034 2:119206413-119206435 TCCTTCTTGAGTGCAGCTTATGG + Intergenic
937136481 2:119558130-119558152 TCTTCCTGGACTCCAGCTTGAGG + Intronic
937729639 2:125213125-125213147 TGCTGCTGCACTCCAGCCTGGGG - Intergenic
938039358 2:128063011-128063033 TGCCACTGTACTGCAGCTTGGGG + Intergenic
938532118 2:132198658-132198680 CACTGCTGGACTGCAGCCTGGGG - Intronic
939797444 2:146663971-146663993 TCCTGCTGGACTGCATCATAAGG - Intergenic
940853408 2:158709483-158709505 TGCCGCTGCACTCCAGCTTGGGG - Intergenic
941849146 2:170161786-170161808 CCCTCCTGGACTGGGGCTTGAGG + Intergenic
943346495 2:186744295-186744317 TCTTACTGGACTCCACCTTGAGG - Intronic
945946321 2:215999133-215999155 TCCTGCATGACTGCAGCACGTGG + Intronic
947235547 2:227937225-227937247 TCCTGGTGGTCTTCAGCTGGGGG - Intergenic
947886322 2:233574876-233574898 TCTTCCTAGACTGAAGCTTGGGG + Intergenic
948258212 2:236583957-236583979 TTCTGCTGTTCTGCAGCCTGGGG + Intergenic
1171190739 20:23157580-23157602 TGCCGCTGGACTCCAGCCTGGGG - Intergenic
1172173142 20:32955496-32955518 CGCTGCTGTACTCCAGCTTGGGG + Intronic
1172838632 20:37888664-37888686 TCCTGCTGGACTCCAGCTCAGGG - Intergenic
1173718248 20:45230174-45230196 TCCTGCTGGACTTTGGATTGAGG + Intergenic
1174194561 20:48763836-48763858 GGCTGCTTGGCTGCAGCTTGGGG + Intronic
1174580192 20:51565940-51565962 CCCTTCTGGGCTGCAGCTTTCGG + Intergenic
1175353043 20:58339891-58339913 TCCTGCAGGACTTCTGCCTGGGG + Intronic
1175996158 20:62813177-62813199 TCCTGCTGGGCTGGGGCCTGGGG - Exonic
1176091975 20:63322238-63322260 CCCTGCCTGTCTGCAGCTTGGGG - Intronic
1176764338 21:13000783-13000805 CACTGCTGGACTGCAGCCTGGGG + Intergenic
1177248827 21:18566695-18566717 TACTGCTACACTGCTGCTTGTGG + Intergenic
1179631125 21:42679390-42679412 TCCTGGTGGATTGCTGCTTCGGG + Intronic
1179657954 21:42857150-42857172 TTCTGCTGGCCTGGAGTTTGGGG - Intronic
1179949965 21:44703902-44703924 TCCAGCTCCACTGCAGCTGGGGG - Intronic
1180136134 21:45863210-45863232 TCCTCATGGACTGCAGGATGAGG - Intronic
1180428921 22:15227279-15227301 CACTGCTGGACTGCAGCCTGGGG + Intergenic
1180838081 22:18941762-18941784 TACTGCTGCACTGCTGCTTGTGG - Intergenic
1181835379 22:25602956-25602978 TGCTACTGCACTCCAGCTTGGGG - Intronic
1183026013 22:35066423-35066445 TCCTGCTGTCCTGCAGGTGGAGG - Exonic
1184267814 22:43359132-43359154 GCCCACTGGACTGCAGGTTGTGG + Intergenic
1185056068 22:48578919-48578941 TCCTGCTGGACAGCGGCTGCTGG - Intronic
949640447 3:6030181-6030203 ATCTCCTGGTCTGCAGCTTGCGG + Intergenic
950030739 3:9851488-9851510 TACTGCTGCACTGCCGCTTGTGG + Intronic
950459487 3:13112696-13112718 GCCTGCTGGCCTGCAGCTTTGGG + Intergenic
950693621 3:14680990-14681012 TCCTGCTGGTTTGCAGATAGTGG - Intronic
954635932 3:52070900-52070922 TCCGCCTGGAGTGCTGCTTGCGG - Intergenic
957021880 3:75137047-75137069 TCCTATGGAACTGCAGCTTGGGG - Intergenic
960027994 3:113030334-113030356 TACTGCTGCACTGCCGCTTGTGG + Intergenic
961051730 3:123752446-123752468 TCCTGCTGGATTGCGGCATCCGG - Exonic
961297054 3:125893382-125893404 TACTGCTGCACTGCTGCTTGTGG - Intergenic
961335836 3:126179317-126179339 CCCTGCAGGACTGCAGCTCTGGG + Intronic
961547237 3:127643678-127643700 TGCTGCTGCACTCCAGCCTGAGG - Intronic
961655261 3:128438360-128438382 TCAGGCTGGGCTGCAGCTGGGGG - Intergenic
962018639 3:131472013-131472035 TGATGCTTGACTGCAGCTTTGGG + Intronic
962167417 3:133063762-133063784 TCCCGCTGGACTCCTGCTTGAGG + Intronic
963288925 3:143466683-143466705 TCCTACTGGATTGTATCTTGAGG + Intronic
963695862 3:148565467-148565489 TACTGCTGCACTGCCGCTTGTGG + Intergenic
963735296 3:149011899-149011921 TGCTGCTTCAGTGCAGCTTGTGG + Intronic
963853293 3:150228361-150228383 TCCTGCTGGCCTGGAGGCTGTGG + Intergenic
966915254 3:184581042-184581064 TCATGCTGGACTGCTGGGTGCGG + Exonic
967026424 3:185568614-185568636 TACTGCTGCACTGCCGCTTGTGG + Intergenic
967986444 3:195098848-195098870 GCCTCCTGGCCTGCAGCCTGGGG + Intronic
968086784 3:195877422-195877444 TCCACCTGCACTGCAGCTTTTGG - Intronic
968536491 4:1133841-1133863 GCATGCTTGACTGCAGCTTGTGG + Intergenic
968800966 4:2743048-2743070 TCCTGAAGCACTGCAGCCTGTGG + Intronic
969021335 4:4142315-4142337 GCCTGCTGGGGTGCAGCTGGGGG + Intergenic
969732527 4:8965101-8965123 GCCTGCTGGGGTGCAGCTGGGGG - Intergenic
969792106 4:9499184-9499206 GCCTGCTGGGGTGCAGCTGGGGG - Intergenic
970512540 4:16795466-16795488 TCCTGCTGGGCTTTATCTTGAGG + Intronic
971231902 4:24806866-24806888 TCCTTCTGGGCTGCACTTTGAGG + Exonic
975011723 4:69363129-69363151 TGCTGCTGCACTCCAGCCTGGGG + Intronic
975130825 4:70831060-70831082 TCCGGCTTGACTGCTCCTTGTGG - Intronic
978562242 4:110045488-110045510 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
979671419 4:123363732-123363754 TCCTGCTGAACACCATCTTGTGG - Intergenic
983215511 4:164998758-164998780 TACTGCTGCACTGCTGCTTGTGG - Intergenic
984253546 4:177363790-177363812 TGCTACTGCACTGCAGCCTGGGG - Intergenic
985648660 5:1097079-1097101 TCCACCAGGAGTGCAGCTTGGGG + Intronic
986344110 5:6818538-6818560 TCTTGGTGGCCTTCAGCTTGTGG - Intergenic
986807895 5:11326179-11326201 TGCTTCTGGCCTGCAGGTTGTGG + Intronic
988380567 5:30493002-30493024 TACTGCTGCACTGCCGCTTGTGG + Intergenic
989667061 5:43866896-43866918 TCCTGCTAGATAGCATCTTGAGG + Intergenic
992771775 5:80055278-80055300 TCCCACTGCACTGCAGCCTGGGG + Intronic
995591780 5:113707060-113707082 TCCTCCTGTCCTGCTGCTTGAGG + Intergenic
996893583 5:128453712-128453734 TCCTGCTGAAATGCAGAGTGGGG + Intronic
999274361 5:150319164-150319186 TCCTCCTGGAATGCAGCTGGAGG - Intronic
999952263 5:156663775-156663797 TACTGCTGCACTGCCGCTTGTGG + Intronic
1000245127 5:159442655-159442677 TGCTGCAGGACAGCAGCTGGGGG + Intergenic
1001578869 5:172784670-172784692 TGCCGCTGCACTGCAGCCTGGGG + Intergenic
1001884891 5:175280503-175280525 TGCTGCTGGGCTACAGATTGAGG + Intergenic
1002075589 5:176706383-176706405 TCCTCCTAGTCTGCACCTTGCGG - Intergenic
1002559429 5:180071634-180071656 CCCTGCTGACCTGCAGCCTGTGG - Exonic
1003070625 6:2942685-2942707 TCACGCTGCACTGCAGCCTGGGG + Intergenic
1006013036 6:31058098-31058120 TGCTTCTGGCCTGCTGCTTGAGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008460320 6:51761980-51762002 TCCTGATGGACTGAATATTGAGG - Intronic
1010301791 6:74269304-74269326 TCTTGCTGGAATCCAGCCTGTGG + Intergenic
1010592047 6:77723264-77723286 TACTGCTGCACTGCCACTTGTGG + Intronic
1011397924 6:86929651-86929673 TCATGCTGATATGCAGCTTGAGG + Intergenic
1013351907 6:109313400-109313422 TCCTGCTGTCCTGCAGCCAGCGG - Intergenic
1013471656 6:110471948-110471970 TCCAGCTGGACTGCAGCCCTGGG + Intronic
1014314691 6:119848839-119848861 TCCTGCTGTGCGGCAGCTAGGGG - Intergenic
1014933753 6:127363707-127363729 TCCTGCTCCTCTGCAGCCTGAGG + Intergenic
1017466108 6:154695116-154695138 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
1017907350 6:158765866-158765888 GGCTGCTGGAAGGCAGCTTGTGG - Exonic
1018082347 6:160269585-160269607 TCCTGGTGGACTCCTGCATGGGG + Intronic
1019915426 7:4129340-4129362 CCCTGGAGGACAGCAGCTTGGGG + Intronic
1019915444 7:4129400-4129422 CCCTGGAGGACAGCAGCTTGGGG + Intronic
1019976722 7:4588787-4588809 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1019977658 7:4597290-4597312 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1020308758 7:6854344-6854366 GCCTGCTGGGGTGCAGCTGGGGG + Intergenic
1021214819 7:17902753-17902775 TCCTAATGGTCTGCAGCCTGGGG - Intronic
1022601088 7:31760516-31760538 TACTGCTGCACTGCAGTGTGGGG - Intronic
1022817065 7:33923982-33924004 TGCAGCTGGACTGCAGGTGGGGG - Intronic
1023189407 7:37563516-37563538 TCCTGCAGGACAGCACCTAGTGG - Intergenic
1023441924 7:40193325-40193347 TGCTGCTGCACTCCAGCCTGGGG - Intronic
1023847457 7:44130591-44130613 CACTGCTGCACTCCAGCTTGGGG - Intergenic
1024044224 7:45576096-45576118 CCCTGCTAAACTGCAGCTAGAGG - Intronic
1025809636 7:64867550-64867572 ACCTGCTTAACTGCAGCATGAGG + Intergenic
1026610908 7:71859102-71859124 TGCCGCTGCACTCCAGCTTGGGG - Intronic
1026949347 7:74337225-74337247 TTAGGCTGGGCTGCAGCTTGGGG + Intronic
1027524656 7:79252113-79252135 TGCTGCTGCACTCCAGCCTGTGG + Intronic
1028925178 7:96349809-96349831 TCCTGTTGTACTGCAGCTGAGGG - Intergenic
1029555412 7:101265390-101265412 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
1029967010 7:104750678-104750700 TACTGCTGCACTGCTGCTTGTGG + Intronic
1030211620 7:107002017-107002039 TGCTGCTGCACTCCAGCCTGGGG + Intergenic
1030716045 7:112808324-112808346 TGCTGCTGCACTCCAGCGTGGGG - Intergenic
1032323959 7:130909338-130909360 TCCTCTTGGACTGCATTTTGTGG + Intergenic
1033446895 7:141431035-141431057 TAGTGCTGCACTGCAGCTGGAGG - Intronic
1033482238 7:141753872-141753894 TACTGCTGCACTGCCACTTGTGG + Intronic
1034672245 7:152867536-152867558 TCCTCCTGGGCTGCAGACTGTGG + Intergenic
1035755999 8:2033573-2033595 TCCTCCTGCACTGAAGCTTTTGG - Intergenic
1036292265 8:7504236-7504258 TACTGCTGCACTGCCGCTTGTGG + Intronic
1041618812 8:59939983-59940005 TGCTGCTGTACTCCAGCCTGGGG + Intergenic
1042199787 8:66270155-66270177 GCCTGCTGGACTGCAGTCTGAGG - Intergenic
1045989562 8:108289791-108289813 TCATGCTGGAATGCAGCTAACGG - Intronic
1047970629 8:130081349-130081371 TCCTGGGTGCCTGCAGCTTGGGG - Intronic
1048880634 8:138869740-138869762 TCCTGGTGACCTGCAGCTGGAGG + Intronic
1050360505 9:4826202-4826224 TGCCGCTGTACTCCAGCTTGGGG + Intronic
1051508991 9:17856851-17856873 TCCTGCTGGTCAGCATCCTGGGG - Intergenic
1052309111 9:27045081-27045103 TCCTACCGGTCTGCAGCCTGGGG - Intronic
1052398762 9:27974247-27974269 TCATGGAGGATTGCAGCTTGAGG - Intronic
1053710739 9:40805219-40805241 CACTGCTGGACTGCAACCTGGGG - Intergenic
1054420650 9:64926016-64926038 CACTGCTGGACTGCAACCTGGGG - Intergenic
1054920631 9:70539321-70539343 TCCTGCTGGCCAGGAGCATGGGG + Intronic
1055022510 9:71685307-71685329 TCCTGCTGGACAGGGCCTTGGGG - Exonic
1056219615 9:84438167-84438189 ACCTGCTGGCCTGCAGGCTGGGG + Intergenic
1056608224 9:88105341-88105363 TCCTGCTGGAAAGCAGGTTTGGG - Intergenic
1057338196 9:94174228-94174250 CCCTCCTGGACTTCAGCTTAAGG - Intergenic
1057759369 9:97860253-97860275 TGGGGATGGACTGCAGCTTGAGG + Intergenic
1060975703 9:127763888-127763910 TGTTGCTGGGCTGTAGCTTGAGG - Intronic
1062442468 9:136576950-136576972 TGCCACTGCACTGCAGCTTGGGG - Intergenic
1062462481 9:136667706-136667728 TCCTGCTGGCTTGCAGCTGCTGG + Intronic
1062487436 9:136786584-136786606 TACTGCTGCACTGCCGCTTGTGG + Intergenic
1062599345 9:137312954-137312976 ACCTGCAGGCCTGCAGCCTGGGG - Intronic
1187688527 X:21840101-21840123 CCCTGCTGCACTGCAGCTGCTGG - Intronic
1190315533 X:49148154-49148176 TCCTACGGAACTGCAGCTTGGGG + Intergenic
1190968951 X:55330415-55330437 TCCAGTTTGACTGCAGCGTGAGG - Intergenic
1191231540 X:58099960-58099982 TCTTGCTGGAGTGCTGCTGGTGG - Intergenic
1199752650 X:150835760-150835782 TTCTAGTGGACTGAAGCTTGGGG - Intronic
1200299046 X:154953925-154953947 TCCAGCTGGAGTGCAGCTTGAGG - Exonic
1200325055 X:155229127-155229149 TCCTACAGGACAGCAGCTAGGGG - Intronic
1200786705 Y:7267063-7267085 TGCTGCTGCACTCCAGCCTGGGG - Intergenic
1200877077 Y:8168317-8168339 TGTTGCTGGCCTGCAGCTAGGGG + Intergenic
1202036724 Y:20644011-20644033 TCCTACAGAACTGCAGCTTGGGG - Intergenic