ID: 926409469

View in Genome Browser
Species Human (GRCh38)
Location 2:12587864-12587886
Sequence CTCCATTAGAAGTTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926409465_926409469 -1 Left 926409465 2:12587842-12587864 CCTGAGTCCACTTTTGTGTTGCC No data
Right 926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG No data
926409464_926409469 18 Left 926409464 2:12587823-12587845 CCTGTGCATGCAGCATTCACCTG No data
Right 926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG No data
926409466_926409469 -8 Left 926409466 2:12587849-12587871 CCACTTTTGTGTTGCCTCCATTA No data
Right 926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926409469 Original CRISPR CTCCATTAGAAGTTGGAACA AGG Intergenic
No off target data available for this crispr