ID: 926410250

View in Genome Browser
Species Human (GRCh38)
Location 2:12595305-12595327
Sequence AAGGTGAGTTCTCATTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926410246_926410250 12 Left 926410246 2:12595270-12595292 CCGTAATTGGTGTTTTCATTCTG No data
Right 926410250 2:12595305-12595327 AAGGTGAGTTCTCATTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926410250 Original CRISPR AAGGTGAGTTCTCATTTTAT AGG Intergenic
No off target data available for this crispr