ID: 926415555

View in Genome Browser
Species Human (GRCh38)
Location 2:12646234-12646256
Sequence CTTTATAAGCAGCATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926415555_926415556 -7 Left 926415555 2:12646234-12646256 CCATTCTCATGCTGCTTATAAAG No data
Right 926415556 2:12646250-12646272 TATAAAGACATACCCAAGACTGG 0: 71
1: 2623
2: 5309
3: 10042
4: 11679
926415555_926415557 -6 Left 926415555 2:12646234-12646256 CCATTCTCATGCTGCTTATAAAG No data
Right 926415557 2:12646251-12646273 ATAAAGACATACCCAAGACTGGG 0: 2136
1: 4078
2: 7251
3: 8542
4: 9456
926415555_926415560 30 Left 926415555 2:12646234-12646256 CCATTCTCATGCTGCTTATAAAG No data
Right 926415560 2:12646287-12646309 AAAGAATTTTAATAGACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926415555 Original CRISPR CTTTATAAGCAGCATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr