ID: 926415569

View in Genome Browser
Species Human (GRCh38)
Location 2:12646334-12646356
Sequence CAATTATGGCAGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926415565_926415569 -1 Left 926415565 2:12646312-12646334 CCACATGGCTGGGAAGGCTTCAC No data
Right 926415569 2:12646334-12646356 CAATTATGGCAGAGGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926415569 Original CRISPR CAATTATGGCAGAGGGTGAA AGG Intergenic
No off target data available for this crispr