ID: 926418560

View in Genome Browser
Species Human (GRCh38)
Location 2:12675048-12675070
Sequence CTGTGGGAACACTGCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926418558_926418560 -9 Left 926418558 2:12675034-12675056 CCTCTGTCTCCAGGCTGTGGGAA No data
Right 926418560 2:12675048-12675070 CTGTGGGAACACTGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926418560 Original CRISPR CTGTGGGAACACTGCATTTC AGG Intergenic
No off target data available for this crispr