ID: 926421441

View in Genome Browser
Species Human (GRCh38)
Location 2:12703747-12703769
Sequence AATAGTGGCCCCACAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926421441_926421447 -8 Left 926421441 2:12703747-12703769 CCCCACCCTGTGGGGCCACTATT No data
Right 926421447 2:12703762-12703784 CCACTATTGTGCCCATCTTCTGG No data
926421441_926421448 -7 Left 926421441 2:12703747-12703769 CCCCACCCTGTGGGGCCACTATT No data
Right 926421448 2:12703763-12703785 CACTATTGTGCCCATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926421441 Original CRISPR AATAGTGGCCCCACAGGGTG GGG (reversed) Intergenic
No off target data available for this crispr