ID: 926423867

View in Genome Browser
Species Human (GRCh38)
Location 2:12723889-12723911
Sequence CTGGCTGCTGAGTGTTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926423867 Original CRISPR CTGGCTGCTGAGTGTTCTGC GGG (reversed) Intronic
900115686 1:1026877-1026899 CTGCCTGCTGGGTGAGCTGCTGG + Intronic
900178266 1:1300187-1300209 CTGGCAGATCAATGTTCTGCAGG - Exonic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
900477983 1:2884968-2884990 CTGTCTGCTGCGCGTTCAGCTGG + Intergenic
900614385 1:3558122-3558144 CTGGGTGATGTGTGTCCTGCAGG - Intronic
900848111 1:5120072-5120094 CTGCCCCCTGTGTGTTCTGCTGG + Intergenic
900947609 1:5840240-5840262 CTGGCTGGACAGTGTTCTCCTGG + Intergenic
901032142 1:6313375-6313397 CTGGCTTCTGAGGTTTTTGCTGG - Intronic
902316825 1:15626826-15626848 CTACCTGCTGATGGTTCTGCTGG - Intronic
902416985 1:16245648-16245670 CTGGCTGGGGAGTGCTGTGCTGG + Intergenic
902564622 1:17303178-17303200 CTGCCTGCTGTGTGTATTGCAGG - Intergenic
903808709 1:26022697-26022719 CTGGCTCCTGCTTGTCCTGCTGG + Exonic
903918268 1:26780260-26780282 CTGGATGCTGAGTTTGCTGAGGG - Exonic
904588816 1:31596105-31596127 CAGGATGCTGAGTGTTGTCCAGG + Intergenic
905513413 1:38542620-38542642 CTGGCTGCTGAAGGCCCTGCTGG + Intergenic
906302929 1:44696893-44696915 CTGGCTGTTCACTGTTCTCCAGG - Intronic
907558471 1:55366555-55366577 CTGACTGCTGTGTGCACTGCTGG + Intergenic
909514193 1:76488877-76488899 CTGGCTGTTGACTGTCCAGCAGG + Intronic
909723976 1:78811512-78811534 CTCTCTTCTAAGTGTTCTGCTGG - Intergenic
909840216 1:80311621-80311643 CTGGCTGCTGAGTGGAGTGAGGG - Intergenic
909974182 1:82025991-82026013 CTGGATGGAGAGTGTTCTGAAGG - Intergenic
910492567 1:87788660-87788682 CTTGTTTCTGAGTGTTCTGTTGG - Intergenic
911592381 1:99763055-99763077 GAAGCTGCTGAGTGTTTTGCGGG - Intronic
912504523 1:110147081-110147103 CCAACTGCTGAATGTTCTGCAGG + Intergenic
912946437 1:114088618-114088640 CTGGCTGCTGGGTGACCTGATGG + Intergenic
913989472 1:143597272-143597294 CTGTATGCTGTGTGTTCTGAGGG - Intergenic
915562707 1:156696679-156696701 CTGGCTGCTGAGAGTCTTTCTGG - Intergenic
915599466 1:156913414-156913436 CTGGCCGCTCAGGGTTCTGCAGG - Exonic
915832265 1:159142029-159142051 ATGGCTTCTGCGTTTTCTGCAGG - Intronic
916188640 1:162157546-162157568 TTGGTTGCTGGGTGTTCTGATGG + Intronic
916739398 1:167635318-167635340 CTGGCTCCCGCGTGTTCTGTGGG + Intronic
920198538 1:204245185-204245207 CTGGCTGTTGAGAGGTGTGCTGG + Intronic
920687451 1:208120136-208120158 CTGGGTGCAGAGTTTTCTGATGG + Intronic
922175096 1:223190445-223190467 TTGGCTGCTGAGCGCTCAGCAGG + Intergenic
922764696 1:228150785-228150807 CTGGCTGCTGGGCGTTCAGGAGG + Intronic
922781541 1:228256714-228256736 CTCGCAGCTGAGTGTGGTGCTGG - Exonic
922899146 1:229122915-229122937 CTTGCTGCTGAGTGGCCTGCAGG + Intergenic
922961436 1:229649742-229649764 CTAGCTGCTGATCATTCTGCTGG - Intronic
923127084 1:231041271-231041293 CTGACTGCTGCGGGTACTGCTGG - Intergenic
923801177 1:237210712-237210734 CTGGGTGCTGTGTGTTGTGGGGG + Intronic
924791691 1:247256479-247256501 CTGCCTCCTGAGTGTGCTCCAGG + Intergenic
1062952699 10:1516548-1516570 CGGGCTGCTGTGTGCTGTGCGGG + Intronic
1063042778 10:2359896-2359918 CTTTCTGCTGTGTCTTCTGCAGG + Intergenic
1063189750 10:3682270-3682292 CTGCCTGCTGTGTGACCTGCGGG - Intergenic
1063932869 10:11046673-11046695 ATGGGTCCTGAGGGTTCTGCGGG - Intronic
1066213053 10:33258664-33258686 CTGGCTTCTGATTCTTCTACAGG + Intronic
1067366870 10:45639751-45639773 CTCATTGCTGAGTGCTCTGCAGG + Intronic
1069604668 10:69731829-69731851 CTGGCTGGTGAGTGTTCTCACGG - Intergenic
1069688690 10:70335442-70335464 CTGGCTGCTGGGGCTGCTGCAGG - Intronic
1070850856 10:79560537-79560559 CTGCAGCCTGAGTGTTCTGCAGG - Intergenic
1070986220 10:80692464-80692486 CAGGGTGCTGAGTTTTCTTCTGG + Intergenic
1072740476 10:97906131-97906153 CTGGAGGCTGAGTGTCCTCCTGG + Intronic
1075027041 10:118992890-118992912 CTGGGTTCTTAGTGTTCTGGTGG + Intergenic
1075971653 10:126659403-126659425 CTGGCTGCTGGCTACTCTGCTGG + Intronic
1076310851 10:129506516-129506538 CTGGCTCCAGATTGTTCTCCAGG + Intronic
1076350763 10:129813701-129813723 CTTCTTGCTGTGTGTTCTGCAGG + Intergenic
1076536004 10:131178133-131178155 CTCCCTGCTGAGCGCTCTGCAGG + Intronic
1078101184 11:8331254-8331276 CTGGCTCCAGAGCGTTCTGGTGG - Intergenic
1078129795 11:8604027-8604049 CTGACTGCTCATTGTTGTGCAGG - Intergenic
1078367108 11:10715813-10715835 CTGGCTGCAGAGTCTGCTTCTGG - Intergenic
1078638576 11:13075133-13075155 CTGGATCCTGAGGGTTCTGATGG - Intergenic
1079349033 11:19677233-19677255 CTGGCTGCAGAGTGATTTCCAGG + Intronic
1083704624 11:64505519-64505541 AAGGCTGCAGAGTGTCCTGCGGG - Intergenic
1084873025 11:72110354-72110376 CAGGCTGGTGCATGTTCTGCAGG + Exonic
1085842491 11:80028881-80028903 TTGCCTGTCGAGTGTTCTGCAGG + Intergenic
1087026908 11:93659135-93659157 CTGGCAGCTGAGAGCTCAGCTGG - Intergenic
1087051071 11:93886932-93886954 GAGGCTGCTGAGTGATCTGGAGG + Intergenic
1087331199 11:96782768-96782790 CTGGCTCCTGGGAGTGCTGCTGG - Intergenic
1087658612 11:100958217-100958239 CTGAATGCTTAGTGTTATGCTGG + Intronic
1089067962 11:115676376-115676398 CTGGCTGCTTAATGTGCTACAGG + Intergenic
1089622751 11:119730994-119731016 CTGGCTGCTGAGTGCTTTAAGGG + Intergenic
1090373642 11:126274195-126274217 CTGGCTTGTGAGTGTTCTGTTGG + Intronic
1093410936 12:18865813-18865835 TTGCCTGCTGATTGTACTGCAGG + Intergenic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1094670572 12:32564253-32564275 CTTGCAGCTGAGTGTTTTGCTGG - Exonic
1095670081 12:44848456-44848478 CCTGTTGCTGTGTGTTCTGCTGG - Intronic
1096851043 12:54437641-54437663 CTGCCTGTTGAGTGTTCACCTGG - Intergenic
1098541734 12:71664442-71664464 CTGGCTGCTAAGCTTTCTTCTGG - Exonic
1100218304 12:92476869-92476891 CTGGCTGCTGAGTGCCCTTTGGG + Intergenic
1100237462 12:92674956-92674978 ATGGCTTCTGAGTGTCCTCCAGG + Intergenic
1101231571 12:102746915-102746937 CTGGCTGCTGAATGTTCCAATGG - Intergenic
1102587200 12:113931718-113931740 CTGGCCTCTGCCTGTTCTGCTGG + Intronic
1103926966 12:124428599-124428621 CTGGCTGCAGAGTGCTCTGTTGG - Intronic
1104319611 12:127738413-127738435 CTGGCTGCTGAGGGTTCCACCGG + Intergenic
1106762188 13:32878199-32878221 CTGGCTGCTGATGGTTCTGACGG + Intergenic
1107726467 13:43304551-43304573 CTATCTGGGGAGTGTTCTGCTGG + Intronic
1111756240 13:92399179-92399201 ATGTGTGCTGAGTGTACTGCAGG + Intronic
1111823396 13:93240977-93240999 CTGGCTTGTGAGTTTTTTGCTGG + Intronic
1112508350 13:99988896-99988918 CAGGCTCCTGAGTGTGGTGCAGG - Intergenic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1114223816 14:20720871-20720893 CGAACTGCTGTGTGTTCTGCTGG + Intergenic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1116392689 14:44412704-44412726 TTGGGTGTTCAGTGTTCTGCAGG + Intergenic
1118809958 14:69265940-69265962 CTGGATGCTGTGTGTTTTACAGG + Intronic
1120596725 14:86448839-86448861 CTGGCTGCTGAGTTTCCTGCTGG + Intergenic
1120730215 14:87993053-87993075 CTTGCTGCTGTGTGCGCTGCTGG - Exonic
1121924686 14:97916950-97916972 CTGCCTGCAGAATGTTGTGCTGG - Intergenic
1122853228 14:104547812-104547834 CTGGCTGATGGGTGGTCTGGAGG + Intronic
1122874453 14:104657212-104657234 CTGTCTGCACAGTTTTCTGCAGG - Intergenic
1124631051 15:31337380-31337402 CTTGCAGCTGTGTGTTCTGAGGG + Intronic
1124648658 15:31458427-31458449 CTGGGCGCTGGGTGTTCTCCTGG + Intergenic
1124906399 15:33872619-33872641 CTGGCTGCTGAGCAAACTGCTGG - Intronic
1124906400 15:33872638-33872660 CTGGCTGCTGAGCAAACTGCTGG - Intronic
1125525405 15:40370918-40370940 ATGGCTGCTGGGTGTGCAGCAGG + Exonic
1127184576 15:56465021-56465043 CTGGCTGCTGCGTTTGCGGCGGG - Exonic
1127458645 15:59178164-59178186 CTACCTGCTTAGTGCTCTGCAGG + Intronic
1127763504 15:62164203-62164225 CTGGCTGCTGAGTACTGTCCGGG - Exonic
1128018990 15:64373727-64373749 CTTGCTGCTCAGTGTGCTGGAGG + Intronic
1128070268 15:64791393-64791415 CTGGCAGCTGATGGATCTGCAGG + Intergenic
1129343263 15:74900137-74900159 CTGAGTGCTGTGTGTTCTGCAGG - Exonic
1129864053 15:78889199-78889221 CTGGCTTCTGAGTCTTTTGAAGG + Intronic
1130909642 15:88262275-88262297 CTGGCCTCTGAGTGTCCTGGTGG + Intergenic
1130982600 15:88823029-88823051 CTGGCAGCTGAGGGTCCTGATGG - Intronic
1131957829 15:97756733-97756755 CTGGGAGCTGAGGGTCCTGCTGG - Intergenic
1132325455 15:100965060-100965082 CAGGCAGCTCACTGTTCTGCAGG - Intronic
1132471661 16:107252-107274 CTGCCTGTTGTGTGATCTGCAGG - Intronic
1132795623 16:1720425-1720447 TTGGCAGGTGTGTGTTCTGCTGG - Intronic
1134572232 16:15300900-15300922 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134572296 16:15301549-15301571 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134730084 16:16454499-16454521 CAGGCTGCTGATTGTTCTCAGGG - Intergenic
1134730149 16:16455148-16455170 CAGGCTGCTGATTGTTCTGAGGG - Intergenic
1134937282 16:18256751-18256773 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1134937348 16:18257401-18257423 CAGGCTGCTGATTGTTCTGAGGG + Intergenic
1135940428 16:26817395-26817417 CTGACTGCTGAGTGGTGTGATGG - Intergenic
1136119017 16:28117371-28117393 CGAACTGCTGCGTGTTCTGCCGG + Exonic
1136277519 16:29187642-29187664 CTGGCTGCTGAGAGTTCTGGAGG + Intergenic
1136988354 16:35134772-35134794 CTGCCTCCTGAGTGTTCTTCAGG + Intergenic
1138212322 16:55173902-55173924 CAGGCTGCTGAAGGTTCTGGTGG + Intergenic
1139506561 16:67400914-67400936 GTGGCTGCCGAGTGTGCTGTGGG - Intronic
1140475046 16:75235582-75235604 CTGGCTGCTGCGTGTGCTGCCGG + Exonic
1140665941 16:77227728-77227750 GTGGCTGCTGATTCTACTGCTGG - Intergenic
1142081896 16:88153684-88153706 CTTGCTGCTGAGAGTTCTGGAGG + Intergenic
1142469179 17:153204-153226 GTGGCTGCTGTGGGTGCTGCTGG - Intronic
1143018681 17:3905024-3905046 GTGGCTGCTGCGTGTCCTGTGGG - Intronic
1144170277 17:12653361-12653383 CAGGCTTCTGAGTTTTCTGAAGG - Intergenic
1144199585 17:12928072-12928094 CTGGCTGCTGTGTTATCAGCAGG - Intronic
1144682040 17:17202718-17202740 CGGGCTGCTGTGCGTTCTGAGGG - Exonic
1144685270 17:17221944-17221966 CAGACTCCTGAGTGTTCTCCAGG - Intronic
1145984114 17:29032878-29032900 CGCGCTGCTGAGAGCTCTGCAGG + Intronic
1146066585 17:29640401-29640423 CTGACTGATTAGTGATCTGCAGG - Intronic
1146726997 17:35164472-35164494 CAGGCTGCAGAGAGGTCTGCAGG - Intronic
1147266869 17:39239780-39239802 GTGGCTGCAGAGTGTGGTGCAGG + Intergenic
1148906149 17:50913504-50913526 CTGGCCACTGAGTGATCTCCAGG - Intergenic
1149641328 17:58204817-58204839 CAGGCTGCTGACGCTTCTGCTGG + Exonic
1150637125 17:66921200-66921222 CTGGCTGCTGGCTGTGATGCTGG - Intergenic
1151369346 17:73638051-73638073 CTGGCTGCTCAGTGCGCTGAGGG + Intronic
1152731468 17:81973617-81973639 CTGGGTGCTGAGTGTGCTCATGG - Intergenic
1154131131 18:11738003-11738025 CTGGACGCTGGGGGTTCTGCCGG - Intronic
1154206868 18:12345020-12345042 CTACCTGCTGTCTGTTCTGCTGG + Intronic
1157131787 18:45014129-45014151 CTGGCTGCTGATTGTACAGCAGG - Intronic
1158860894 18:61591395-61591417 CTGCCTCCTGAGAGTTCTCCAGG + Intergenic
1160011535 18:75110134-75110156 GTGGCTCCTGTGTGATCTGCGGG - Intergenic
1160228897 18:77031813-77031835 CTGGCTGCAGAGTGGGCCGCAGG + Intronic
1160557191 18:79733592-79733614 CTCGTTTCTGCGTGTTCTGCTGG + Intronic
1161527698 19:4767386-4767408 CTACCTGCTGAGTGATCTGAAGG - Intergenic
1163322706 19:16583942-16583964 CTGTGTGCTGAGGGTTGTGCTGG - Intronic
1163455482 19:17403718-17403740 CCAGCTGCTGATTGTGCTGCTGG - Exonic
1163638157 19:18447070-18447092 CTGGGTGCTCTGTGTCCTGCAGG - Intronic
1164468703 19:28510240-28510262 CCGGCTTCTGAATATTCTGCTGG - Intergenic
1165046145 19:33106569-33106591 CTGCCTGCTGAGTGTTAACCCGG + Intronic
1165825921 19:38705688-38705710 CTGTCTGCAGTGTGTTCTGGTGG + Intronic
1165924605 19:39319752-39319774 CAGGATGCTGAATGTGCTGCAGG - Intergenic
1167412570 19:49353662-49353684 CTGGGGGCTGAGGGTTTTGCAGG - Intronic
1167423192 19:49415630-49415652 CTGGGAGCTGAGTGTCCTGGAGG - Intronic
1168357558 19:55711889-55711911 CAGGCTCCTCAGTGTTTTGCAGG + Exonic
1168708053 19:58480793-58480815 CTGCCTCCAGAGTCTTCTGCTGG - Exonic
925114914 2:1370172-1370194 GTGGCTGCTGTGGGTTCTGAGGG - Intergenic
925231999 2:2241493-2241515 CTCCCAGCTGAGTTTTCTGCAGG - Intronic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
926907290 2:17817273-17817295 CTGGCAGGTAAGTGTTCTGGTGG - Intergenic
927486071 2:23489228-23489250 CGGGGTGCTGAGTGATGTGCTGG + Intronic
927521653 2:23702689-23702711 CAGGATGCTGAGTGGTCTGAAGG - Intronic
927857534 2:26536824-26536846 CTGGCTGCTGTAGGTTCTCCAGG - Intronic
928302842 2:30141909-30141931 CAGGATGCAGAGTGTTCTCCTGG + Intergenic
928381678 2:30823594-30823616 TTGGCTGCTGAGTGTTTTCTGGG + Intergenic
931786924 2:65628242-65628264 CTGTCAGCTGAGAGTTCAGCTGG - Intergenic
932344469 2:70986619-70986641 CTGGCTCCTGAGTGATCTCGGGG + Exonic
932494947 2:72141566-72141588 CTGGCTGCAGTGTGGGCTGCTGG - Intronic
932775476 2:74525748-74525770 CTGGCTGCTCTGCCTTCTGCAGG - Exonic
933276404 2:80288877-80288899 CTCGCTGCTGAATGTGTTGCTGG + Intronic
933569394 2:83991765-83991787 TGGGCTTCTGAGTGTGCTGCTGG + Intergenic
936182089 2:110275779-110275801 CTGGCAGCTCAGTGGTGTGCTGG - Intergenic
936230479 2:110695894-110695916 CTGGCAGCTCAGTGGTGTGCTGG + Intergenic
936263284 2:110980213-110980235 CTGGGTGCTGAGTGCTCTACAGG - Intronic
936919448 2:117672618-117672640 CAGGCTGCCCAGTGTTCGGCTGG + Intergenic
937212130 2:120281308-120281330 CTGGCTGGAGACTGTCCTGCCGG - Intronic
944309932 2:198222202-198222224 ATGGCTGCTGATTTTGCTGCAGG + Intronic
944483451 2:200180210-200180232 TTGGCCACTGAGCGTTCTGCAGG - Intergenic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
948351643 2:237345756-237345778 CTGCCTGCTTGGTCTTCTGCAGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169350237 20:4862907-4862929 CAGTCTCCTGTGTGTTCTGCAGG - Exonic
1169736736 20:8845901-8845923 CTGGCTGCCAAGTGTCCTGTAGG + Intronic
1170028688 20:11920532-11920554 CTGTCTGGTGGGTCTTCTGCAGG + Intronic
1170083073 20:12498044-12498066 CTGGTTGCTGAGTGTTGTAGTGG + Intergenic
1170408911 20:16067449-16067471 CTGTCAGCTGAGAGCTCTGCAGG - Intergenic
1171239008 20:23550352-23550374 CAGGCTGCTGAGTGATGGGCAGG - Intergenic
1171419731 20:25009946-25009968 GAGGCAGCTGAGAGTTCTGCTGG + Intronic
1172062468 20:32196021-32196043 CTGACTGCTGTGGGGTCTGCAGG + Exonic
1172766113 20:37351846-37351868 CTGGCTGCTGAGTAATTTGTGGG + Intronic
1173551157 20:43933989-43934011 CTGGGAGCTGCGTGTGCTGCAGG + Intronic
1175837176 20:62003731-62003753 CTGGCTGCAGTGGGTTCAGCTGG + Exonic
1175880334 20:62254349-62254371 CTGGCTCCTCAGTGCTCTGAAGG + Intronic
1176009979 20:62888019-62888041 ATGGCTCCTGAGGGTGCTGCGGG + Intronic
1177482938 21:21715706-21715728 CTGCCTGCTGAGTCTTCTCTAGG - Intergenic
1178788541 21:35676645-35676667 CTGGCTGCCCTTTGTTCTGCTGG + Intronic
1179500917 21:41808171-41808193 CGGGCTGCTGGGTGGGCTGCAGG + Intronic
1179800156 21:43807976-43807998 CTGGCAGTTGGGAGTTCTGCAGG + Intergenic
1180639707 22:17288494-17288516 CTGAGTGCTGTGTGTTGTGCTGG - Intergenic
1181950000 22:26547008-26547030 ATCACTGCAGAGTGTTCTGCTGG + Intronic
1182532685 22:30972866-30972888 CTGATTGCTGAGTGTTCACCTGG + Intergenic
1182892576 22:33831386-33831408 CTGTCTTCAGAGTGTTCTGGAGG - Intronic
1183987940 22:41579557-41579579 CTGTCAGCTGAATGTCCTGCTGG - Intronic
1184232509 22:43166303-43166325 CTGGCTGCTGGGGCGTCTGCAGG - Intergenic
1184408901 22:44315428-44315450 CAGGCTGCTGGGTGTGGTGCCGG + Intergenic
1184454664 22:44602622-44602644 ATGGCTGCTGAGAGCTCTGGAGG - Intergenic
1184633684 22:45807596-45807618 CTTGCTGGAGGGTGTTCTGCAGG + Intronic
1184744456 22:46448162-46448184 CTGGGTGCTGGGTGTGCTCCTGG + Intronic
1185150163 22:49159670-49159692 ATGGTTAGTGAGTGTTCTGCAGG - Intergenic
1185169895 22:49286618-49286640 TCGGCTGCTGAGTGTTCAGGTGG - Intergenic
950522746 3:13506287-13506309 CAGGCTGCTGTGTGTGCTGGAGG + Exonic
950589598 3:13927169-13927191 CTGCCTGCTGAGTATCCTCCCGG + Intergenic
950606864 3:14089516-14089538 CTGCCTGTTGAGTGTCCTCCAGG - Intergenic
950748825 3:15112669-15112691 CTGGGATCTGAGTGCTCTGCTGG - Intergenic
950838396 3:15942616-15942638 CTGGCTGCAGGGAGTGCTGCTGG + Intergenic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
951237753 3:20254776-20254798 ATGGCTGCTCAGTTTTGTGCTGG + Intergenic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
953376296 3:42431265-42431287 CTGGCTGCTGGGAGTGCTACTGG + Intergenic
953930056 3:47001366-47001388 TTGGCTGCTGCGTCTGCTGCAGG + Exonic
955300347 3:57772260-57772282 CTGCCTCCTGACTGTTCTTCTGG - Intronic
959605934 3:108241969-108241991 CTGGCTGCTTTGTGATCTGGGGG + Intergenic
960595259 3:119402376-119402398 CTGGGAGCTGAGACTTCTGCAGG + Exonic
960895818 3:122503927-122503949 GTGGCTGCTGGGTGTTTTGGGGG + Intronic
961328717 3:126126620-126126642 CGGGCTGCTGAGTGTTCCCAGGG + Intronic
961793566 3:129393737-129393759 CTGGCTGCTGAGTCTTGGGCTGG + Intergenic
964473707 3:157080000-157080022 CCGGCTGCTGACCTTTCTGCTGG - Intergenic
964523458 3:157591706-157591728 CTGGCTGTGCAGTGTTCTCCAGG - Intronic
965074546 3:163959765-163959787 CTGTCATCTGAGTATTCTGCTGG + Intergenic
967374296 3:188783353-188783375 ATGGCTGCTTAGTATTCTGTGGG - Intronic
969042117 4:4307244-4307266 CTGGCTGCTGGGTGTTCTCCTGG - Intronic
969334162 4:6497159-6497181 CCTGCTGCTGGGTGTCCTGCCGG - Intronic
970383870 4:15536642-15536664 ATGGCTGCTCAGTGTTCAGTGGG + Intronic
973848235 4:54934885-54934907 CTGTCAGCTGAGGGCTCTGCAGG - Intergenic
976085832 4:81406353-81406375 CAAGATGCTGAGTGTTCTTCTGG + Intergenic
976564320 4:86536187-86536209 CTGCCTGCTGAGTGTTCAAGAGG - Intronic
981005067 4:139866105-139866127 CTGCCTCCTGGGGGTTCTGCAGG - Intronic
983566867 4:169162755-169162777 CTGGCTGCAGAGTCTACTTCTGG - Intronic
985864205 5:2500734-2500756 CGTGTTGCTCAGTGTTCTGCAGG + Intergenic
987281509 5:16418673-16418695 CTGGCTTCTGAGTGCTTAGCAGG - Intergenic
989224931 5:39015977-39015999 TTGGCTGCTTAGTGATGTGCTGG - Intronic
991135840 5:63180820-63180842 CTGGCTGCTGAATGTTCCCAGGG - Intergenic
993111096 5:83658241-83658263 CTGGCTGCTCATTCTCCTGCAGG - Intronic
994640083 5:102396813-102396835 CTGGCTGGTGGGTACTCTGCAGG + Intronic
997591538 5:135076172-135076194 CTGCCTGCAGAATGTACTGCGGG + Intronic
998038796 5:138937814-138937836 CTGCCTGCTTAGTGCCCTGCAGG + Intergenic
1001196116 5:169675028-169675050 CTTGGTGCTAAGTGTTTTGCAGG + Intronic
1001378820 5:171288690-171288712 CTGGGTGCTCAGTGCTCTGCTGG - Intronic
1001575108 5:172758170-172758192 GTGGCTGTTGAGAGCTCTGCGGG + Intergenic
1001879913 5:175234387-175234409 CTGTCTGCTGTGTGTTCTCAGGG - Intergenic
1002439329 5:179256211-179256233 CTGGCGGCTTACTGTTCTGTGGG - Intronic
1002687486 5:181024957-181024979 CTGGCTGGTGAGTGTGCTAGTGG - Intergenic
1004090280 6:12494107-12494129 CTGTCTGCTCTGTGTGCTGCAGG + Intergenic
1006393128 6:33770626-33770648 AGGGCTGCTGAGTGTGCTTCTGG - Intergenic
1006906131 6:37535097-37535119 CTTGCTGCAGAATGTTCTGCGGG + Intergenic
1007227340 6:40324493-40324515 CTGTCTGCTGCCTGTGCTGCTGG + Intergenic
1007340107 6:41185992-41186014 CCTGCTGTTGAGAGTTCTGCTGG - Intergenic
1007628114 6:43257931-43257953 CCGTCTGCCGGGTGTTCTGCTGG - Exonic
1009603369 6:65833424-65833446 CTGTCAGCTGAGAGTTCAGCTGG + Intergenic
1009603472 6:65834923-65834945 CTGTCAGCTGAGAGTTCAGCTGG + Intergenic
1013189102 6:107786808-107786830 GTGGTTGCTGAGTCCTCTGCAGG - Intronic
1013950874 6:115780478-115780500 CTGGCTACTGTATGTACTGCAGG - Intergenic
1014515532 6:122374074-122374096 CTGGCTGCTGTGTGGTCAACTGG - Intergenic
1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG + Intronic
1016399002 6:143657907-143657929 CTGGCTGCTAGGAGTGCTGCTGG - Intronic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1017028542 6:150201460-150201482 CTGGCTGGGGAGTGTCCTGAGGG + Intronic
1018058563 6:160072195-160072217 TGGGCTGCTGTGTGTTCTCCTGG + Intronic
1018742705 6:166742831-166742853 CTGGCTTCTCAGTGTTTTGCAGG - Intronic
1018742776 6:166743362-166743384 CTGGTTGCTGGGCGTTCTGTGGG - Intronic
1021985273 7:26092109-26092131 CTGTCTCCTGAGGGTCCTGCTGG - Intergenic
1022099996 7:27163826-27163848 TTGGCTGCTGGGTTATCTGCGGG + Exonic
1022881154 7:34588694-34588716 CTTGATCCAGAGTGTTCTGCAGG - Intergenic
1024231514 7:47367298-47367320 CTGCCTGCTGAGTGTTTCCCTGG + Intronic
1025640907 7:63367862-63367884 CTGGCTCTTGAGTGTGCTCCAGG - Intergenic
1026134131 7:67644385-67644407 CTTGCTGCTGACTGTCCTCCTGG - Intergenic
1029039440 7:97557222-97557244 CTGGCCCATGAGTGTTCTACAGG + Intergenic
1030309216 7:108052769-108052791 CTTGCTGGTGAGTGTTCCCCTGG + Intronic
1031938000 7:127755650-127755672 CTGGCTGCTGCATATTCTGAAGG - Intronic
1032191697 7:129769531-129769553 CTGGCTCCTGAGCCATCTGCAGG + Intergenic
1032591182 7:133193818-133193840 GTGCCTGCTGACTGTTCTGTGGG + Intergenic
1032656253 7:133933663-133933685 CTGGCTGCGAGGTCTTCTGCAGG + Intronic
1033357031 7:140608276-140608298 CTGATTGCTGAGTGTTCAGGGGG - Intronic
1035053984 7:156021655-156021677 GTGGCAGCAGAGTGTTTTGCTGG - Intergenic
1035069231 7:156128997-156129019 CTGGTTGCTCAGTGTTCTCAAGG + Intergenic
1035474972 7:159136875-159136897 CTGGCTGCTTCCTGTCCTGCTGG - Intronic
1036075517 8:5494694-5494716 CTGGCTCCTGATTGGGCTGCTGG - Intergenic
1036381065 8:8236780-8236802 GTGTCTGCTGATTGGTCTGCTGG - Intergenic
1037753881 8:21699298-21699320 CTGGCTGCAGAGTCGGCTGCAGG + Intronic
1041380915 8:57253742-57253764 CTGGGTGCTGCGGGTGCTGCTGG + Intergenic
1047977085 8:130141405-130141427 CTGATTGATGAGAGTTCTGCAGG - Intronic
1049241974 8:141542661-141542683 CTAACTGCTCTGTGTTCTGCAGG + Intergenic
1049320392 8:141993140-141993162 CTGGCTGGTGCGTGCTCTGTGGG + Intergenic
1049569865 8:143364345-143364367 CTGGGTGCTGAGTGTGCTTAGGG - Intergenic
1049600791 8:143506673-143506695 CCTGCTGCTGAGTTTTCTGGAGG - Intronic
1050151173 9:2621369-2621391 GCTGCTGCTGCGTGTTCTGCCGG + Intergenic
1057748817 9:97773465-97773487 CTGACTCCTAAGTCTTCTGCAGG - Intergenic
1058609748 9:106762847-106762869 CTTTCTCCTAAGTGTTCTGCAGG - Intergenic
1058809145 9:108622231-108622253 CTAGCTGCTGGTGGTTCTGCTGG - Intergenic
1058893175 9:109378762-109378784 CTGGGTGCTGAGTGTGCAGTAGG + Exonic
1062436274 9:136547870-136547892 CTGGCTGCTGGGTGGCCTGACGG - Intergenic
1185537837 X:876315-876337 ATGAATGCTGAGGGTTCTGCAGG - Intergenic
1190330116 X:49230590-49230612 CAGGCTGTTCAGCGTTCTGCTGG - Exonic
1197138992 X:123095991-123096013 CTGGCTGCTGGGAGTTCAGGGGG - Intergenic
1197179578 X:123519975-123519997 CTTGCTGCTGACAGTGCTGCTGG - Intergenic
1198891578 X:141403016-141403038 CTGGCTGCTCAGGGTTGTGGAGG + Intergenic
1200013934 X:153144421-153144443 ATGGCTGCTGAGTGATCGGTGGG - Intergenic
1200025666 X:153255532-153255554 ATGGCTGCTGAGTGATCGGTGGG + Intergenic
1200086970 X:153611720-153611742 CTGCCTGCTGAGGTTTCTGAAGG - Intergenic
1200716730 Y:6555408-6555430 ATGGCTTCTAAGTGTTCTGGTGG - Intergenic