ID: 926423878

View in Genome Browser
Species Human (GRCh38)
Location 2:12724053-12724075
Sequence CACGGACCTCTATTCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926423878_926423887 2 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423887 2:12724078-12724100 GGGTGGGATGAGAACTGGGGTGG 0: 1
1: 0
2: 4
3: 57
4: 561
926423878_926423884 -3 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423884 2:12724073-12724095 GTGCTGGGTGGGATGAGAACTGG 0: 1
1: 0
2: 0
3: 33
4: 279
926423878_926423891 27 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423891 2:12724103-12724125 GGGACATGTCAGTTCTCCCTAGG 0: 1
1: 0
2: 1
3: 10
4: 170
926423878_926423889 6 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423889 2:12724082-12724104 GGGATGAGAACTGGGGTGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 392
926423878_926423885 -2 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423885 2:12724074-12724096 TGCTGGGTGGGATGAGAACTGGG 0: 1
1: 0
2: 2
3: 38
4: 341
926423878_926423886 -1 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423886 2:12724075-12724097 GCTGGGTGGGATGAGAACTGGGG 0: 1
1: 0
2: 3
3: 26
4: 303
926423878_926423888 5 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423888 2:12724081-12724103 TGGGATGAGAACTGGGGTGGTGG 0: 1
1: 1
2: 6
3: 71
4: 596
926423878_926423890 7 Left 926423878 2:12724053-12724075 CCAGCTCAGAATAGAGGTCCGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 926423890 2:12724083-12724105 GGATGAGAACTGGGGTGGTGGGG 0: 1
1: 0
2: 2
3: 44
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926423878 Original CRISPR CACGGACCTCTATTCTGAGC TGG (reversed) Intronic
901454133 1:9353588-9353610 CACGGTCATCTCTTCAGAGCAGG - Intronic
906126413 1:43429799-43429821 CATGGGCCTCTCCTCTGAGCTGG - Exonic
913157821 1:116117382-116117404 CAGGGACCTGAAGTCTGAGCAGG - Intronic
913259089 1:116982477-116982499 CAAGGTCCTCTGTGCTGAGCAGG + Intronic
913547311 1:119881970-119881992 CACCCAACTTTATTCTGAGCAGG + Intergenic
1065701613 10:28431272-28431294 CACCAGCCTCCATTCTGAGCAGG - Intergenic
1076604822 10:131682660-131682682 CGGGGACCTCTCTTCTGGGCAGG - Intergenic
1076823293 10:132952751-132952773 CACGGACCTCTCTTCAGCTCTGG + Intergenic
1077918767 11:6627554-6627576 CCCGGGCCTCTATCCTCAGCTGG + Exonic
1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG + Intergenic
1086347576 11:85912781-85912803 CACTGCCCTCTTTTCTGAACTGG + Intronic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1092174725 12:6395576-6395598 CAAGAACCTCTATTGTAAGCTGG + Intergenic
1101861017 12:108482372-108482394 CACGGATCTCAAATCTGACCGGG + Intergenic
1102650688 12:114440101-114440123 CCCGGACCTCGATTCCAAGCAGG + Intergenic
1102949517 12:117020996-117021018 CATGCACCTCACTTCTGAGCCGG - Intronic
1103023095 12:117552358-117552380 CACGGACCTCAACTCTTAGTGGG - Intronic
1106017725 13:25885010-25885032 CAGGGCCCACTATCCTGAGCTGG + Intronic
1106150814 13:27100010-27100032 CATAGACTTCTACTCTGAGCAGG - Intronic
1106777166 13:33019640-33019662 CCAAGACCTCCATTCTGAGCAGG - Intronic
1132855342 16:2042440-2042462 CGGGGGCCTCTATTCTGAGCCGG - Intronic
1132925475 16:2427155-2427177 CACTCACCTCTCTTCTGAGACGG + Intergenic
1139040191 16:62990841-62990863 CATGGACCTCTGTGCTCAGCTGG + Intergenic
1139843649 16:69902980-69903002 CAGGGACATTTAATCTGAGCAGG + Intronic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1150831846 17:68528704-68528726 CAATTACCTCTAGTCTGAGCAGG - Intronic
1151526393 17:74671807-74671829 CACGCATCTCTGTTTTGAGCAGG - Intronic
1152531708 17:80922838-80922860 CACGGACCTGCAGGCTGAGCGGG - Intronic
1153382305 18:4454248-4454270 CAGGGACCTCTCCTCTGGGCTGG - Intronic
1155093941 18:22537636-22537658 CACTGACCACAATTCTGACCTGG + Intergenic
1160155754 18:76432686-76432708 CACGGCCCTCTGTACTGAGGTGG + Intronic
1164529448 19:29037114-29037136 AACAGACATCTATGCTGAGCAGG - Intergenic
1166407024 19:42528695-42528717 CACTGACCTCTATTGTGTCCTGG + Intronic
926423878 2:12724053-12724075 CACGGACCTCTATTCTGAGCTGG - Intronic
927323629 2:21777817-21777839 CTAGGACCTCTATTCTTGGCAGG + Intergenic
929234423 2:39591178-39591200 CACGGCCCTTTTTTCTGAGCAGG + Intergenic
930023828 2:47017659-47017681 CACAGTCCACTATGCTGAGCTGG - Intronic
937077938 2:119120723-119120745 CACCAAGGTCTATTCTGAGCTGG + Intergenic
938581619 2:132651660-132651682 TACAGAGCTCTATTCTGATCTGG + Intronic
945275149 2:207980696-207980718 CATGTACCTGTATTCTCAGCTGG - Intronic
947917198 2:233840602-233840624 CACCTACCTCTCTTCTGAGTTGG + Exonic
1170579079 20:17684371-17684393 CACAAGCCTCTATTCTGTGCAGG - Intergenic
1172052929 20:32132991-32133013 CCCTGGCCTCTCTTCTGAGCAGG + Exonic
1178155736 21:29851773-29851795 CACTGACTTCTCTTCTGAACTGG + Intronic
1181411662 22:22726935-22726957 CACTGACCTATCTTCAGAGCTGG - Intergenic
1181418713 22:22781234-22781256 CACTGACCTATCTTCAGAGCTGG - Intronic
1185338624 22:50281937-50281959 CCCCGGCCTCTGTTCTGAGCAGG + Exonic
957553012 3:81731166-81731188 CACAGACCTCTGGCCTGAGCAGG + Intronic
971354874 4:25886448-25886470 CCCCTACCTCCATTCTGAGCAGG + Intronic
971998508 4:33997299-33997321 TACGGAAGTCTTTTCTGAGCTGG + Intergenic
987101504 5:14595129-14595151 CAGGGACATCAACTCTGAGCTGG - Intronic
1001029415 5:168250965-168250987 CACGGACGGCCTTTCTGAGCAGG + Intronic
1005123856 6:22422652-22422674 GACAGACCTTAATTCTGAGCAGG - Intergenic
1008709140 6:54202212-54202234 CAGCGACCTCTTTTCTGAACAGG + Exonic
1018985392 6:168632871-168632893 CGCTGACCTCTATTCAGAGATGG + Intronic
1029086755 7:98018031-98018053 CACTGACCCCTACTCTGGGCTGG + Intergenic
1034312012 7:150096928-150096950 CAGGGGCATCTTTTCTGAGCAGG - Intergenic
1034794846 7:154003730-154003752 CAGGGGCATCTTTTCTGAGCAGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1043230124 8:77789761-77789783 CACTCACCACTTTTCTGAGCAGG + Intergenic
1045417931 8:101985352-101985374 CACAAATCTCTAATCTGAGCTGG - Intronic
1045734655 8:105280616-105280638 CATGGACATCTATCCTGAGAAGG + Intronic
1048169642 8:132093779-132093801 CACAGACTTCTATCCTCAGCAGG + Intronic
1057520899 9:95759464-95759486 GACCGACCTCTATTCCGACCTGG - Intergenic
1057629528 9:96707976-96707998 CACTGACCTCTATTCGAAGATGG + Intergenic
1060549130 9:124476924-124476946 CATGGAACCCTATTCTGAGCGGG + Intronic
1195748037 X:108138040-108138062 CACGGATCTCTGTGCTGAGATGG - Intronic