ID: 926424825

View in Genome Browser
Species Human (GRCh38)
Location 2:12731277-12731299
Sequence AGCACAGCCCTCCCTACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926424825_926424833 12 Left 926424825 2:12731277-12731299 CCGTGTGTAGGGAGGGCTGTGCT 0: 1
1: 0
2: 2
3: 23
4: 219
Right 926424833 2:12731312-12731334 CCTGTGCCAGGACAGAGATGAGG 0: 1
1: 0
2: 4
3: 43
4: 360
926424825_926424829 0 Left 926424825 2:12731277-12731299 CCGTGTGTAGGGAGGGCTGTGCT 0: 1
1: 0
2: 2
3: 23
4: 219
Right 926424829 2:12731300-12731322 GCTGGAGGGTCCCCTGTGCCAGG 0: 1
1: 0
2: 6
3: 109
4: 1245
926424825_926424836 24 Left 926424825 2:12731277-12731299 CCGTGTGTAGGGAGGGCTGTGCT 0: 1
1: 0
2: 2
3: 23
4: 219
Right 926424836 2:12731324-12731346 CAGAGATGAGGCTGAGTCCAGGG 0: 1
1: 1
2: 6
3: 66
4: 437
926424825_926424835 23 Left 926424825 2:12731277-12731299 CCGTGTGTAGGGAGGGCTGTGCT 0: 1
1: 0
2: 2
3: 23
4: 219
Right 926424835 2:12731323-12731345 ACAGAGATGAGGCTGAGTCCAGG 0: 1
1: 1
2: 3
3: 66
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926424825 Original CRISPR AGCACAGCCCTCCCTACACA CGG (reversed) Intronic
900168925 1:1256934-1256956 AGAACAGCCCCCCAGACACAAGG + Intronic
900482128 1:2904474-2904496 AGCTCAGCCCTCCCTCCCCAGGG - Intergenic
901229124 1:7632135-7632157 GGCACAGCCTTCCCTGCACCTGG - Intronic
901422179 1:9158563-9158585 AGCACTGTCCTCCCTCCACCAGG - Intergenic
901536028 1:9883478-9883500 ATCACAGCCCTCACTAAGCATGG + Intronic
901698682 1:11031142-11031164 AGCACACCTCTTCCTCCACATGG - Intronic
902245636 1:15118738-15118760 AGCAAAGCCCTAACCACACAAGG + Intergenic
902416983 1:16245646-16245668 AGCACAGCACTCCCCAGCCAGGG - Intergenic
902513715 1:16979284-16979306 CTCGCAGCCCTCCCTACAGAAGG - Intronic
902646970 1:17806420-17806442 AGTACAGCCCTCCCTGAACCCGG + Intronic
904003232 1:27350171-27350193 AGCCCAGCCCACCATTCACAGGG + Intronic
904045689 1:27607044-27607066 AGCACGGCCCTCCCTGAATATGG + Intergenic
906126855 1:43432216-43432238 AGGGCAGTCCTCCCTACACATGG - Intronic
907482336 1:54753992-54754014 AGCCCAGCCCTGTCTAGACAAGG - Intergenic
910700690 1:90071091-90071113 AGCACAGACCTCCATAAACCAGG + Intergenic
911540309 1:99149909-99149931 ACAACAGCCCTCCCTAACCATGG + Intergenic
912991537 1:114492140-114492162 TTCACAGTCATCCCTACACATGG - Intronic
914666833 1:149839729-149839751 TGCAGAGCCCACTCTACACACGG - Exonic
914668934 1:149854061-149854083 TGCAGAGCCCACTCTACACACGG + Exonic
919466523 1:197926792-197926814 AGCCCAGACTTCCCTTCACACGG - Intronic
920494074 1:206441761-206441783 AGTACAGCCCTTACTCCACAGGG - Intronic
922793301 1:228322625-228322647 AAGTCAGCCCTCCCTATACAGGG + Intronic
924106213 1:240651740-240651762 AGACCAGCCCTACCAACACAGGG + Intergenic
1062843086 10:686334-686356 AGCACAGCCTTCCCCCCACGTGG + Intronic
1064015928 10:11772358-11772380 ACCACAGCCCTCACCCCACAGGG + Intergenic
1066226666 10:33389996-33390018 AGCAGAGCACTCACTCCACAAGG - Intergenic
1066954033 10:42149062-42149084 CGCACAGCCCACCCCACCCACGG + Intergenic
1067070224 10:43125702-43125724 AGCACAGCCCTGCCCTCACGGGG + Intronic
1069934370 10:71905212-71905234 AGCACAGCCCTGTCCACACCTGG + Intergenic
1070963504 10:80515649-80515671 AGCCCTGCCCACCCCACACAGGG - Intronic
1071373904 10:84982957-84982979 AGAGCAGCCCTCACCACACACGG + Intergenic
1073603600 10:104871004-104871026 AGAGCAGCCCTCCATACTCATGG + Intronic
1073921525 10:108465602-108465624 CACACACCCCTCCCTACACTGGG + Intergenic
1074831735 10:117254395-117254417 AGCATGCCCATCCCTACACAGGG - Exonic
1077283022 11:1754093-1754115 CTCACAGCCCTCCTTGCACAGGG + Exonic
1077296631 11:1829484-1829506 AACACAGACCCCCCTAAACAAGG + Intronic
1077863161 11:6200621-6200643 ATCACAGCCCTCTCTACTCCTGG + Intergenic
1078146190 11:8723184-8723206 AACACAGCCCTCTCTGCCCACGG - Intronic
1078151390 11:8762353-8762375 AGAACTGCCCTCCCTAGATAGGG + Intronic
1079242693 11:18731902-18731924 ATTACAGCCTTCCCTAAACATGG + Intronic
1080776973 11:35395101-35395123 CCCACTGCCCTCCCTACTCAGGG - Intronic
1083121052 11:60512085-60512107 AGCACAGCCCTTTCTCCATAGGG - Intergenic
1083949791 11:65947604-65947626 AGCACAGGACTCCCTGCAGAAGG + Exonic
1084121072 11:67069287-67069309 AGAGCAGCCCTCCCTCCACCAGG + Intronic
1085373763 11:76038860-76038882 AGCTCAGCCCTACCACCACAAGG + Intronic
1085471431 11:76760875-76760897 AGCTCAGCCCTTGCTCCACACGG - Intergenic
1089599275 11:119603537-119603559 ACAACAGCCCTCCCTGGACATGG - Intergenic
1090661019 11:128881476-128881498 AGCACATCTCTCCCTACAGGGGG - Intergenic
1091122174 11:133065509-133065531 AGCGATGCCCTTCCTACACACGG - Intronic
1091308734 11:134558193-134558215 AGCTCAGCCTTCTCTACACAAGG - Intergenic
1093950698 12:25162994-25163016 AGCAGATCGCTCCCTTCACAGGG - Intronic
1097352539 12:58564228-58564250 AGCACAGCCCACTCAACAAATGG - Intronic
1101544433 12:105698149-105698171 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1102568089 12:113810184-113810206 AGCACGGCCCTGCCCACACCTGG + Intergenic
1103618450 12:122170729-122170751 ACCACATCCCTCCTTACATATGG + Intronic
1104745784 12:131209615-131209637 AGCTCAGTCCTCCCTCCAGAGGG + Intergenic
1104966450 12:132510575-132510597 AGCTCAGCCCTGTCTAGACAAGG - Intronic
1106455431 13:29922786-29922808 AGCTCAGCCCTCCCCACTCATGG - Intergenic
1108481545 13:50877622-50877644 ACCTCCACCCTCCCTACACAAGG - Intergenic
1110767355 13:79296115-79296137 AGCACAGCCCACCGTGCCCATGG - Intergenic
1111452165 13:88433744-88433766 AGCAGGACCCTCCCTACATAAGG + Intergenic
1112274594 13:98004690-98004712 AGCACAGTCCACACTAAACATGG + Intronic
1113442630 13:110341044-110341066 AGCACACCCCTCCCCACCCCTGG - Intronic
1114055988 14:18967321-18967343 AGCCCAGCCCACCCCACCCAGGG - Intergenic
1114106561 14:19434432-19434454 AGCCCAGCCCACCCCACCCAGGG + Intergenic
1118808815 14:69259654-69259676 CGCCCAGCCGCCCCTACACAAGG + Intronic
1119175654 14:72566084-72566106 AGCACAGGCCTCTCTTCAGAGGG - Intronic
1121173979 14:91876724-91876746 AGCACAGCCCTGCTGACACCTGG + Intronic
1121662368 14:95645072-95645094 AGCACAGCACTTCACACACAGGG - Intergenic
1121693074 14:95891800-95891822 AGCACAGCCCTGCTGACACTTGG - Intergenic
1122503254 14:102215765-102215787 TGCAGAGCGCTTCCTACACAGGG + Intronic
1122884616 14:104705500-104705522 AGCACAGCCCTCCGCAGGCAGGG - Intronic
1122906725 14:104805062-104805084 AGCCCAGCCCAGCCTGCACAGGG - Intergenic
1122919415 14:104873918-104873940 ACCTCAGCCCGCCCGACACATGG - Intronic
1123499373 15:20866428-20866450 AGCCCAGCCCACCCCACCCAGGG + Intergenic
1123515336 15:21026487-21026509 AGCACATCCCTGTCTACCCAGGG - Intergenic
1123556625 15:21440158-21440180 AGCCCAGCCCACCCCACCCAGGG + Exonic
1123592847 15:21877393-21877415 AGCCCAGCCCACCCCACCCAGGG + Intergenic
1124124816 15:26929643-26929665 AGCGCAGCCCTCACCACACCAGG + Intronic
1124442324 15:29696207-29696229 AGTCCTGCCCTCCCTGCACAGGG + Intergenic
1126424735 15:48515182-48515204 AAGACAGCCCTCCCAACACCTGG + Intronic
1126618606 15:50613706-50613728 AGCACAGCCCTACCGACCAAAGG - Exonic
1127694595 15:61433034-61433056 AGCACAGCAAGCCCTACCCAAGG - Intergenic
1130039827 15:80397250-80397272 AGCACATATCTCACTACACAAGG - Intronic
1131335798 15:91547385-91547407 AGAACAGCCCTCACTGGACATGG + Intergenic
1202964964 15_KI270727v1_random:167347-167369 AGCCCAGCCCACCCCACCCAGGG + Intergenic
1132463496 16:67054-67076 CCCCCAGCCCTCCCTCCACAGGG + Intronic
1132712723 16:1276629-1276651 CACACAGCCCTCCCTTCCCAGGG - Intergenic
1134382743 16:13743399-13743421 AGCTCAGCCCTCAACACACAAGG + Intergenic
1136283873 16:29230194-29230216 AGCACCGTCCTCCCTGCACCTGG - Intergenic
1136289387 16:29262262-29262284 CTCACAGCCCTCCCTGCCCATGG + Intergenic
1137620850 16:49875948-49875970 ACCACAGCCCTACCCACAAAAGG - Intergenic
1138615036 16:58158419-58158441 AGCACAGGCCCTCCTACACGTGG - Intronic
1140281425 16:73558416-73558438 AGCATTGCCCTCCCACCACATGG - Intergenic
1140454224 16:75095465-75095487 CTCACAGCCCTCCCTAGCCATGG + Intronic
1140859510 16:79006677-79006699 AGCCCAGCCCCACCTACACCTGG - Intronic
1141223037 16:82089631-82089653 AGCACAGCCCTGCTAACACTTGG - Intronic
1142088905 16:88199704-88199726 AGCACTGTCCTCCCTGCACCTGG - Intergenic
1142095129 16:88235242-88235264 CTCACAGCCCTCCCTGCCCATGG + Intergenic
1142170535 16:88619803-88619825 AGCGCGGCCCTTCCAACACAGGG - Intronic
1142434689 16:90048562-90048584 CACACAGCCCTCCAGACACACGG + Intergenic
1143772913 17:9179728-9179750 CGCAGAGCCTTCCCTACCCAGGG - Intronic
1145799644 17:27674682-27674704 ACCTCAGCCCTCCCTGCCCAGGG + Intergenic
1146302949 17:31705477-31705499 AGCAATGCCTTACCTACACACGG + Intergenic
1146863300 17:36323535-36323557 ACCTCAGCCCTCCCTGCCCAGGG - Intronic
1147066160 17:37924123-37924145 ACCTCAGCCCTCCCTGCCCAGGG - Intergenic
1147093630 17:38127618-38127640 ACCTCAGCCCTCCCTGCCCAGGG - Intergenic
1147678004 17:42220506-42220528 AGCACAGCAATCCCTCCTCAGGG + Intronic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1148149788 17:45389775-45389797 AGCTCAGCCCTCCCTCACCACGG - Intergenic
1149848156 17:60019388-60019410 ACCTCAGCCCTCCCTGCCCAGGG + Intergenic
1150086508 17:62275970-62275992 ACCTCAGCCCTCCCTGCCCAGGG + Intronic
1150292634 17:63990493-63990515 AGCACAGCCCTCCCTCAGCCCGG - Intergenic
1150810205 17:68350298-68350320 AACACAGCTCTCCCTACTCCTGG + Intronic
1150957085 17:69870935-69870957 AGCACATTCCTCCCTACAGTAGG + Intergenic
1151339012 17:73457759-73457781 AGCAGATCCCTCCCTAACCAAGG + Intronic
1151447967 17:74179540-74179562 AGCACAGCCCTTCCGACACCTGG + Intergenic
1152578786 17:81156945-81156967 CCCACAGGCCTCCCGACACAGGG + Intronic
1153574598 18:6507943-6507965 GGCACAGCCCTGCCTACATAGGG - Intergenic
1154210128 18:12372528-12372550 AGCAATGCCATCCCTACCCAAGG + Intronic
1155561239 18:27079724-27079746 AGCACAACCCTGCCCACTCACGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1161730733 19:5959081-5959103 AGCACAGCCCCCTCTTCTCAGGG - Intronic
1163646651 19:18493392-18493414 AGCACAGCCCTGGCTTCAGAGGG - Intronic
1165320126 19:35080039-35080061 AGCACAGCCCTCACAGCCCAGGG + Intergenic
1165739165 19:38195453-38195475 AGCACACCCCTGCCCTCACAGGG + Intronic
1166155473 19:40908458-40908480 AGCACAGCCCTCCCTCAGCAAGG + Intergenic
1166365429 19:42275901-42275923 GACACAGCCCTACTTACACAGGG + Intronic
1167008158 19:46788510-46788532 ACCACCGCCTTCCGTACACAGGG - Exonic
1167119188 19:47506709-47506731 AGCACAGCCAACCCTGCACGGGG + Intronic
925257681 2:2504010-2504032 GGCACAGGCCTCCCTGCCCAGGG + Intergenic
926424825 2:12731277-12731299 AGCACAGCCCTCCCTACACACGG - Intronic
932503865 2:72210067-72210089 AGATCAGCACACCCTACACATGG - Intronic
935044118 2:99464018-99464040 AGTGTAGTCCTCCCTACACATGG + Intronic
935621796 2:105136500-105136522 AACACAGCCCTGCCGACACCTGG - Intergenic
937698525 2:124836979-124837001 AGCAAAGCCCTCACAACCCAAGG + Intronic
938286322 2:130120667-130120689 AGCCCAGCCCACCCCACCCAGGG + Intronic
938429285 2:131218229-131218251 AGCCCAGCCCACCCCACCCAGGG - Exonic
938474129 2:131591531-131591553 AGCACAGCCCACCCCACCCCAGG - Intergenic
940041999 2:149370551-149370573 AGAACAGCCCTCACCAGACACGG + Intronic
946413527 2:219527443-219527465 AACCGAGCCCACCCTACACAGGG - Intronic
947503859 2:230692019-230692041 ACCACAGCCGTCCCTAGACAAGG + Intergenic
948363246 2:237437400-237437422 AGCACAGCCCTGCCCACACCTGG + Intergenic
948393986 2:237631304-237631326 TGCAAAGCCCTGCCTGCACAGGG - Intronic
948504846 2:238421873-238421895 AGCGCAGCCCTGCCTGCACCTGG - Intergenic
948606628 2:239139831-239139853 AGCACGGCCCTCCCTCCGCATGG - Intronic
948612848 2:239180729-239180751 AGCACACCCTTCCATCCACATGG - Intronic
1169969428 20:11253292-11253314 AGCACAGCCCTGCAAACTCAAGG - Intergenic
1172093754 20:32450772-32450794 AGCCCTGCCCCCCCTACACATGG - Intronic
1174193371 20:48756034-48756056 GGCACTGCCTTCCCTGCACAGGG - Intronic
1174551890 20:51368130-51368152 AGCACAGCCCTGCTGACACACGG - Intergenic
1174554181 20:51382338-51382360 AGCGCAGCCCTCCTGACACCAGG + Intergenic
1175146659 20:56901637-56901659 AGCACAGCCCTGCTCACACTGGG + Intergenic
1175183851 20:57166719-57166741 AGCACAGCCCTGCTGACACCTGG + Intergenic
1175456119 20:59115816-59115838 ATCACAGCCCACCCTACTCCAGG - Intergenic
1175634507 20:60569317-60569339 CCCACAGCCTTCCCTACACTGGG - Intergenic
1175943362 20:62547922-62547944 ACCACAGCCCTCGCCCCACAGGG - Intergenic
1176816725 21:13610060-13610082 AGCCCAGCCCACCCCACCCAGGG - Intronic
1178422168 21:32451631-32451653 AGCACAGCCCTGCCAACACCTGG - Intronic
1178688019 21:34726639-34726661 AGCACAGCCCTGCTGACACCTGG + Intergenic
1179613863 21:42569369-42569391 TGCAAAGCCCTCCCGCCACATGG + Intronic
1180127994 21:45805089-45805111 GGCACAGGCCTTCCCACACACGG - Intronic
1180474467 22:15689913-15689935 AGCCCAGCCCACCCCACCCAGGG - Intergenic
1181314058 22:21960653-21960675 AGGGCAGCCCTCCCTGTACAGGG + Intronic
1181495590 22:23285758-23285780 AAGACTGCCCTCCCTACTCATGG - Intronic
1182760323 22:32717438-32717460 TGCACAGCCCTCACTGCTCAGGG - Intronic
1182787407 22:32919186-32919208 AGCTCCACCCTCCATACACACGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184244865 22:43230832-43230854 AGAACAGCCCTCGCTCCTCAGGG + Intronic
1184354712 22:43971360-43971382 AGCCCAGCCCGCTCTGCACAAGG + Intronic
1184710547 22:46247029-46247051 CTCCCAGCCCTCCCTACCCAGGG + Intronic
1184764436 22:46564195-46564217 AGCACAGACCTCCCTAGAGGGGG - Intergenic
950790023 3:15464156-15464178 AGGAGAGACCTCCCTAGACATGG + Intronic
954965197 3:54604388-54604410 ATCTCAGCCCTGCCTACTCAGGG + Intronic
955689737 3:61579226-61579248 ATCACAGCACTCCCTAGAAAGGG - Intronic
956922058 3:73940408-73940430 AGCACAGCCCTGCTAACACTTGG - Intergenic
959573601 3:107910819-107910841 AGCACGGCCCTGCCAACACCTGG + Intergenic
961456958 3:127029120-127029142 AGCACAGGCCTCCCTCCCCTTGG + Intronic
962928449 3:140016089-140016111 TGGACAGGCCTCCCTAGACAGGG + Intronic
963933763 3:151031763-151031785 ATCACAGCACATCCTACACATGG + Intergenic
964397006 3:156256435-156256457 AGGACTGCCCTCCCTCCCCAGGG + Intronic
965993509 3:174849534-174849556 AGACCAGCCCTGCCAACACAGGG + Intronic
966216725 3:177511045-177511067 AGCACCACCCTCCCTCCAGATGG - Intergenic
967303159 3:188036767-188036789 ATCACAGACCTCCCTACCTAGGG + Intergenic
968992927 4:3926870-3926892 AGCACAGCCCTGCCAACACCTGG + Intergenic
969291877 4:6245424-6245446 AGCACCGCACTCCCTGCCCAGGG - Intergenic
969310959 4:6353067-6353089 AGCACGGCCCTGCCAACACCTGG + Intronic
969391394 4:6893573-6893595 AGCTCAGCCATCCCTGCACCAGG - Intergenic
969628406 4:8320570-8320592 AGAACAGCCGTCCCTCCTCATGG + Intergenic
969822547 4:9731491-9731513 AGCACAGCCCTGCCAACACCTGG - Intergenic
970583630 4:17494988-17495010 AGCAAAGCCCCTCCTACACCAGG - Intronic
974329823 4:60463930-60463952 AGCTCAGCACTCCCTAGCCATGG - Intergenic
979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG + Intergenic
979728652 4:123995214-123995236 AGCTCAGCCCTCCCTCCAGAAGG + Intergenic
994044523 5:95293045-95293067 AACACAGCCCTGCCAACACTTGG - Intergenic
997713198 5:136023331-136023353 AGCACAGTGCTCACTACACGGGG + Intergenic
997839068 5:137221901-137221923 AGCAGCGCCCACCCTCCACAGGG + Intronic
998599353 5:143569211-143569233 AGCCCACCCCTCCCTGCATAGGG - Intergenic
998910989 5:146960054-146960076 AACACAGCCATCCCTACAGAGGG - Intronic
998931900 5:147190569-147190591 AGCTGGGCCCTCCCTCCACATGG + Intergenic
999256759 5:150213802-150213824 AGCCCAGCCCTGCCTGCCCAGGG + Intronic
1002160166 5:177310370-177310392 AGCACAGCCCTCCATACACCAGG + Intronic
1006100700 6:31684362-31684384 AGGACACCCCTCCCTGGACATGG - Intergenic
1006278174 6:33022692-33022714 AGCACAGCACTCACTAAACCAGG - Intergenic
1006432464 6:34006054-34006076 TGCACCCCCCTCCCTACTCATGG + Intergenic
1007357714 6:41333310-41333332 AGGCCAGCCCTCCCTTCCCATGG + Intergenic
1009678511 6:66859648-66859670 AGAACAGACCTCCCAACCCAGGG + Intergenic
1011433555 6:87314257-87314279 ACCTTAGCCCTCCCTACCCAAGG + Intronic
1012616399 6:101283955-101283977 AGCACAGCCCTACAAAGACATGG + Intergenic
1015820695 6:137257453-137257475 AACACAGCCCTGCCTACCCTTGG - Intergenic
1019630448 7:2046179-2046201 AGCCCCGCCCTCCCTACAGAGGG + Intronic
1021665673 7:22976061-22976083 AGCTCAGCCTACCCAACACATGG - Intronic
1022011145 7:26309074-26309096 AGCACAGCCCTCCATTCATGGGG + Intronic
1023048875 7:36234702-36234724 AGCACATGCCTCCCTCCAAAGGG - Intronic
1023684813 7:42723388-42723410 AACACAGCCCACACCACACAGGG + Intergenic
1024090025 7:45929170-45929192 AGCACAGCCCTGCCATCACCTGG + Intergenic
1024919433 7:54542391-54542413 ATCACTGCCCTCCCTAAACACGG - Exonic
1029471194 7:100755304-100755326 GACACAGCCCTCCCGACAGAGGG - Exonic
1032706737 7:134426544-134426566 AGCACAGCCTCCCCTCCACAGGG - Intergenic
1033707499 7:143903295-143903317 AACACATCCCTGCCTACACCTGG - Intergenic
1034102989 7:148466988-148467010 AGCACATCCCTCCCCAGGCAGGG + Intergenic
1034678614 7:152910881-152910903 ACCCCAGGCCTCCCTTCACAGGG + Intergenic
1035288205 7:157819584-157819606 AGCACAGCCCTCCCGCCACAAGG + Intronic
1035559330 8:593278-593300 TTCACATCCCTCCCTTCACAGGG - Intergenic
1036170116 8:6475611-6475633 AGCATTGCCCTCCCGACTCATGG - Intronic
1037750140 8:21676295-21676317 AGATCAGCCCTCCCAGCACATGG - Intergenic
1038169510 8:25116213-25116235 AGTGCAGCCCTGCCTACACCTGG + Intergenic
1039766374 8:40632682-40632704 AGCACAGCCCTGCCAACACCTGG + Intronic
1046679189 8:117149885-117149907 AAAACAGCCCTCCCATCACAGGG + Intronic
1049805522 8:144537100-144537122 AGCACAGCCCTGGGTTCACAGGG + Intronic
1053161817 9:35818682-35818704 AGCACAGCCATCTCTGCAAAAGG + Intronic
1053288844 9:36866890-36866912 GGCACAGCCCAATCTACACAGGG + Intronic
1056821524 9:89845516-89845538 AGCCCAGGCCTCCCTGCACAAGG + Intergenic
1057336751 9:94161654-94161676 AGCAAAGTCCTCCCTAAATAGGG + Intergenic
1060860712 9:126952502-126952524 AGCATGGCCATCCTTACACAAGG + Intronic
1061279112 9:129586914-129586936 AGCACCGCCCTCCCTGCCCCAGG + Intergenic
1061818302 9:133208851-133208873 AGGTGAGCCCTCCCTCCACAGGG + Intronic
1061896297 9:133650053-133650075 AGCATAGTCCTCCCTCCACCTGG + Intronic
1062039554 9:134397822-134397844 CACACAGCCCTCCCCACACAAGG - Intronic
1062242150 9:135546507-135546529 AGGTGAGCCCTCCCTCCACAGGG - Intronic
1062474094 9:136719049-136719071 GGCACAGCCTTCCCCACCCATGG - Intronic
1203530636 Un_GL000213v1:139434-139456 AGCCCAGCCCACCCCACCCAGGG + Intergenic
1191972045 X:66827497-66827519 AGCACAGCCCTGCCTCAACTAGG + Intergenic
1199927218 X:152480319-152480341 ACAACAGCCCTCCCTGGACATGG + Intergenic
1200069568 X:153521271-153521293 AGCACCGCCCACCCAACAGAAGG - Intronic