ID: 926426469

View in Genome Browser
Species Human (GRCh38)
Location 2:12743105-12743127
Sequence ACACTCTCCCTGAGAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926426469_926426474 27 Left 926426469 2:12743105-12743127 CCAGATGTTCTCAGGGAGAGTGT 0: 1
1: 0
2: 0
3: 14
4: 137
Right 926426474 2:12743155-12743177 ACGTAGGGCACAAGTAATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 41
926426469_926426471 11 Left 926426469 2:12743105-12743127 CCAGATGTTCTCAGGGAGAGTGT 0: 1
1: 0
2: 0
3: 14
4: 137
Right 926426471 2:12743139-12743161 TAGAGTAACCAGGATTACGTAGG 0: 1
1: 0
2: 0
3: 2
4: 34
926426469_926426472 12 Left 926426469 2:12743105-12743127 CCAGATGTTCTCAGGGAGAGTGT 0: 1
1: 0
2: 0
3: 14
4: 137
Right 926426472 2:12743140-12743162 AGAGTAACCAGGATTACGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 109
926426469_926426470 1 Left 926426469 2:12743105-12743127 CCAGATGTTCTCAGGGAGAGTGT 0: 1
1: 0
2: 0
3: 14
4: 137
Right 926426470 2:12743129-12743151 GTAATAGCTCTAGAGTAACCAGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926426469 Original CRISPR ACACTCTCCCTGAGAACATC TGG (reversed) Intergenic
900700330 1:4044426-4044448 ACACTCTCTCTGAAGACATTGGG - Intergenic
912279215 1:108295687-108295709 GAACTCTCCCAGAAAACATCAGG - Intergenic
912289011 1:108398670-108398692 GAACTCTCCCAGAAAACATCAGG + Intronic
912300683 1:108513645-108513667 AGATTCTCCCTTAGAACCTCTGG - Intergenic
913427566 1:118750952-118750974 GCTCTTTTCCTGAGAACATCCGG - Intergenic
915339369 1:155167797-155167819 AGAGCCTCCCTGAGAAGATCTGG - Intergenic
916116619 1:161490180-161490202 TCCCTCTCCCTGGGAACACCTGG + Intergenic
920767855 1:208850682-208850704 AGCCATTCCCTGAGAACATCGGG - Intergenic
924651325 1:245930108-245930130 ATACTCCCCCTAAAAACATCAGG + Intronic
1065100655 10:22328227-22328249 ACACAATCCCTGATAAAATCTGG - Intronic
1065345277 10:24742318-24742340 ACACTCCACCTGAGTACATGAGG - Intergenic
1074955258 10:118382549-118382571 ACAGTCAGGCTGAGAACATCTGG + Intergenic
1080749201 11:35137421-35137443 ACTCTCTCCTGGAGAACACCAGG - Intergenic
1081220136 11:40449901-40449923 GAACTCACCCTGAGAACATGAGG + Intronic
1081374134 11:42339389-42339411 ACAGTCTTCCTAAGAACACCAGG + Intergenic
1081907835 11:46680507-46680529 ACAGTCTCCCTGAGTACAATGGG + Exonic
1084634035 11:70378118-70378140 AGACTCTCCCTGCAAACTTCCGG + Exonic
1088590947 11:111402648-111402670 ACACTAACCCTGAGAGGATCTGG - Intronic
1089997054 11:122918459-122918481 AGAGTCTCCCTGAGAAGATATGG + Intronic
1091643339 12:2254228-2254250 CCCCACTCCCTGAGAACAACTGG - Intronic
1093111968 12:15163531-15163553 ACACTCTCACTGAGCAGATCTGG - Intronic
1095214780 12:39535181-39535203 CCACTCTCCCTGACCACATTTGG + Intergenic
1097290601 12:57911196-57911218 GGACTCTCCCTTAGAACCTCAGG + Intergenic
1097602651 12:61713553-61713575 GCACCCTCCCTGACAACCTCAGG + Intronic
1098738628 12:74141437-74141459 TCACTATCACTGAGAACAGCAGG - Intergenic
1102356969 12:112245534-112245556 AGGTTCTCCCTGAGAACTTCAGG - Intronic
1104050037 12:125188669-125188691 AGACTCTCCCAAAGAACAGCAGG - Intronic
1104785092 12:131444043-131444065 ACACTGTCCCTGAGGCCACCTGG - Intergenic
1105542881 13:21329897-21329919 AGACTCTCCCTGAAGACATCAGG - Intergenic
1109053403 13:57513919-57513941 AAATTCTCCATGAGAACACCTGG + Intergenic
1109928134 13:69174813-69174835 AAACTCTCTCTGTCAACATCTGG - Intergenic
1110409921 13:75193802-75193824 ACACTCTCCCGTATAAAATCAGG + Intergenic
1110645053 13:77873176-77873198 ACACTCTTCCTCAGAACAGCTGG + Intergenic
1110848240 13:80214469-80214491 ATATTATCCCTGAGAAAATCAGG - Intergenic
1111607609 13:90561247-90561269 TCAGTCTCCCTGAGAACTTTGGG - Intergenic
1112822751 13:103355468-103355490 AGACTCTCCCTCAGAGCCTCTGG + Intergenic
1114155103 14:20093589-20093611 TTATTCTCCCTGAGAACGTCTGG - Intergenic
1114206767 14:20579272-20579294 ACATTCTCACAGAGAACATGGGG + Intergenic
1118505082 14:66402429-66402451 CCACTATCCCTGGGAACATCTGG + Intergenic
1122605228 14:102943664-102943686 CCTCTCTCCCTGAGCACATGGGG - Intronic
1124560519 15:30769893-30769915 ACACTCTCCCTGGAAGCACCAGG + Intronic
1125421613 15:39510269-39510291 ACACTCACCCTGACATCACCTGG - Intergenic
1125708801 15:41766744-41766766 TCACTCTCCCCTTGAACATCAGG - Exonic
1133176264 16:4017282-4017304 ACACCCTCCCTGAGAATACAAGG + Intronic
1133386495 16:5374343-5374365 AGGCTCTCCCTGAGGAGATCAGG + Intergenic
1133733655 16:8597264-8597286 TCAGTCTCCCTGGGAACCTCTGG - Intergenic
1135919765 16:26639061-26639083 AGATTCTCCCTCAGAACCTCCGG + Intergenic
1138739439 16:59290794-59290816 ACACTCTTCAGGAGAACATGGGG + Intergenic
1141883059 16:86872632-86872654 ACCCTGTCCCTGAGAAGATCTGG + Intergenic
1142868284 17:2804535-2804557 ACACAGCCCCTGAGAACATCAGG - Intronic
1143337103 17:6179547-6179569 ACACACACCCCCAGAACATCAGG + Intergenic
1145006645 17:19342343-19342365 GCACTTGCCCTGAGACCATCTGG - Intronic
1146697033 17:34917227-34917249 ACCATCTTCCTGAGCACATCTGG + Intergenic
1147483609 17:40790681-40790703 ACACTATCTCAGAGAACACCAGG - Intergenic
1147556498 17:41482516-41482538 ACAGTCTCCCTGGGAAAATAGGG - Intergenic
1149017386 17:51924305-51924327 ACACTCTCACTGGGAACAAAAGG + Intronic
1149124496 17:53211244-53211266 TCTCTCCCCCTGTGAACATCAGG - Intergenic
1151322895 17:73362041-73362063 CCGTTCTCCCTGAGAACAGCAGG - Intronic
1151675795 17:75596754-75596776 ACACTCCTCCTGGGAACAGCCGG - Intergenic
1157053529 18:44198183-44198205 CTACTCTCACTGAGAACTTCTGG + Intergenic
1157587774 18:48816145-48816167 ACCTTCTCCCTGGGACCATCAGG + Intronic
1160106713 18:75984542-75984564 ACACGGTCCCTAAGAATATCTGG - Intergenic
1160721993 19:601865-601887 AAACTCTCCCTGGGAAGCTCTGG - Intronic
1162110712 19:8398188-8398210 ACACTTTCCCTGAGCAGAGCAGG - Intronic
1164927198 19:32139809-32139831 TCTCTTTCCCTGAGAAAATCTGG + Intergenic
1168627272 19:57929334-57929356 AGGCTCCCTCTGAGAACATCAGG + Intronic
925521782 2:4754548-4754570 ACATACTCCCTTAGAACATTCGG - Intergenic
926426469 2:12743105-12743127 ACACTCTCCCTGAGAACATCTGG - Intergenic
930318612 2:49827404-49827426 CCACTCTCCCTGACTCCATCAGG + Intergenic
930516578 2:52414950-52414972 GCACTTTCCTTGAGAACCTCGGG - Intergenic
933729516 2:85446328-85446350 ACCCTCTCCCTGATAGCAACAGG - Intergenic
935846254 2:107168585-107168607 ACACTCCCGCTAAGAACACCTGG - Intergenic
937032039 2:118748792-118748814 ACACTGTCCCAGAGATCAACAGG + Intergenic
938029345 2:127979264-127979286 GGATTCTCCCTGAGAACCTCCGG + Intronic
939029883 2:137059535-137059557 CCTCTCTCCCTGAGAACCCCTGG + Intronic
939399363 2:141670857-141670879 AAACTCTGTCTGAGAACATCTGG + Intronic
941544635 2:166833547-166833569 ACACCCTCACTGAGAAGATGAGG + Intergenic
942125489 2:172821144-172821166 ACAATTTACCTGAGAACTTCTGG - Intronic
946157285 2:217815334-217815356 AGATTCTCCCCTAGAACATCAGG + Intronic
1168819649 20:764286-764308 ACATTCTCCCTGTGACCCTCAGG - Intronic
1168994518 20:2123064-2123086 ACACTCTCCCTGGTAACACGTGG - Intronic
1170704499 20:18733133-18733155 ACAGTCCCCCTGAGGACACCTGG - Intronic
1170779235 20:19409040-19409062 GAACTCTCCCTGATAATATCTGG - Intronic
1173392606 20:42648413-42648435 ACACATTCCTTGAGAGCATCAGG - Intronic
1176086198 20:63296647-63296669 CCACTCTGCCTGAGAACGTCAGG - Intronic
1178216448 21:30604776-30604798 AAACTGTCTCTGAGAGCATCCGG + Intergenic
1179463341 21:41553019-41553041 AAACTCTACCTGAGAAAAACAGG - Intergenic
1183122888 22:35744455-35744477 ATACTCTCCTTGAGAATATCAGG - Intronic
954642418 3:52108988-52109010 AAACTCTCCTGGAGGACATCAGG + Intronic
956097057 3:65727906-65727928 TCACTCTCCCTGACATCACCCGG - Intronic
958852972 3:99350943-99350965 AGACTGTCCCTGAGAAAACCAGG + Intergenic
960100330 3:113735707-113735729 ACAGTCTCCCTCAGAAGCTCAGG + Intronic
962241654 3:133755534-133755556 ACTCTCACCCTGAGGACATTTGG - Intronic
962812399 3:138970935-138970957 TCACTCCCCCTGAGAGCATCAGG - Intergenic
963962322 3:151323187-151323209 CCTCTCTCCCTGAGAATGTCTGG + Intronic
965846926 3:172973842-172973864 CCATTCTCCTTGAGAACACCTGG - Intronic
966333119 3:178837792-178837814 AAACTACCACTGAGAACATCTGG - Intronic
969252844 4:5981350-5981372 ATGCTTTCCCTGAGATCATCAGG + Intronic
974349619 4:60727860-60727882 ACACTGTTGCTAAGAACATCAGG - Intergenic
975625706 4:76344604-76344626 TCTCTCTCACTGAGCACATCAGG - Intronic
976267464 4:83197554-83197576 ACAGACTCCCTGAGAAAAACGGG + Intergenic
976413178 4:84740682-84740704 GCAGTCTCCCTGAGAACACGAGG + Intronic
976668057 4:87621515-87621537 CCAATCACCCTGAGAACACCAGG + Intergenic
976873573 4:89826581-89826603 ACAGTCTCCATTAGATCATCAGG + Intronic
979974118 4:127174738-127174760 ACATTCTCCTTAGGAACATCTGG + Intergenic
982229178 4:153192825-153192847 ACACTTTCTGTGAGAAGATCTGG - Intronic
983877521 4:172893893-172893915 ACACTCCCACTGTGGACATCTGG - Intronic
988179838 5:27775843-27775865 ACACTCTCCCTGGTATCATACGG - Intergenic
988205741 5:28131165-28131187 ACTCTATCCCTGAAAACATATGG - Intergenic
990917014 5:60918359-60918381 ACACTGTATCTGTGAACATCAGG + Exonic
991517887 5:67459570-67459592 ACACCTTCCCTGAGAATATTGGG - Intergenic
992750654 5:79857610-79857632 ACACCCACCCTGAGAACCACTGG - Intergenic
994834098 5:104827369-104827391 ACACTGCTCCTGAGAAAATCTGG + Intergenic
999126553 5:149250377-149250399 TCCCTCTCCCTGAGGTCATCTGG - Intronic
999190961 5:149747439-149747461 ACACTCACCCTCTGAGCATCAGG - Intronic
1001083723 5:168685552-168685574 ACACTCAGCTTGAGGACATCTGG - Intronic
1003409125 6:5847890-5847912 AGACTTTCCCTGAAGACATCAGG + Intergenic
1005462238 6:26080189-26080211 AGACTCACCCTGATAACTTCTGG + Intergenic
1006991622 6:38219649-38219671 ACACTCATCTTGAGACCATCTGG - Intronic
1007719191 6:43875419-43875441 ACAGACACCCTGGGAACATCTGG - Intergenic
1011163412 6:84418754-84418776 AGGCTCTCCCTGAGAGCCTCTGG - Intergenic
1011773584 6:90702752-90702774 ACTCTCACCTTGAGAAAATCAGG - Intergenic
1013662250 6:112309457-112309479 ACACACTGCCTGAGGACAACTGG + Intergenic
1018277895 6:162152694-162152716 ACACTCTCCTTGACAATATTGGG - Intronic
1018873326 6:167799438-167799460 CCACACTCCCTGACACCATCTGG + Intergenic
1018984118 6:168622917-168622939 ACACTCAGCCCGAGTACATCCGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020642213 7:10769456-10769478 ACACTCTTCCTGAGAAAACTGGG + Intergenic
1021774989 7:24044803-24044825 AGACTCTCCCTGAGAGCTACTGG + Intergenic
1022396881 7:29996588-29996610 AGATTCTCCCTGAGAGCCTCTGG - Intergenic
1024890579 7:54196835-54196857 ACATTCTCCCTCAGAGCCTCCGG + Intergenic
1026291031 7:69006272-69006294 ACATTCTGCCTGAGACCATGAGG - Intergenic
1030236898 7:107273585-107273607 ATCCTCTCAATGAGAACATCTGG + Intronic
1035298293 7:157879307-157879329 ACAGCCTCCATGAGAACAGCAGG + Intronic
1035655420 8:1301603-1301625 ACCCTCTCCCAGAGTCCATCAGG - Intergenic
1035737280 8:1898036-1898058 CTCCTCTCCCTGAGCACATCAGG - Intronic
1044759754 8:95505752-95505774 ACAGTCTCCTAGAGAATATCTGG + Intergenic
1045916986 8:107483973-107483995 GCATTTTCCCTAAGAACATCAGG + Intronic
1049285264 8:141771473-141771495 CCTCTTTCCCTGAGAACATCTGG + Intergenic
1053123682 9:35563222-35563244 AGACTCTCCCTGGGAACCTCAGG + Exonic
1053510859 9:38686790-38686812 ACACCCTGCCTGTGAACTTCTGG - Intergenic
1054882955 9:70164072-70164094 AAAATCTCCCTGAGAACCACTGG - Intronic
1059520319 9:114934600-114934622 ACAATCTCCAAGAGATCATCTGG + Intergenic
1062198822 9:135289833-135289855 ACAGTCCCCCTGAGACCTTCTGG + Intergenic
1186948628 X:14597218-14597240 ACTCTTTCACTGAGAACATAAGG - Intronic
1188371945 X:29379583-29379605 CCACTCTCACTGTGAACCTCTGG - Intronic
1188896761 X:35678456-35678478 ACATTCTTACTGAGACCATCAGG + Intergenic
1193062139 X:77218207-77218229 ACACACTCTCTTAGAACATCTGG - Intergenic
1193629421 X:83863928-83863950 AGAGTCTCCCTTAGAACCTCTGG - Intronic
1194799145 X:98250049-98250071 ACACTCTTCCAAAGAACATCAGG - Intergenic
1198586500 X:138128156-138128178 ACACCCTCCCTGTGAAAATAAGG - Intergenic
1199672783 X:150160868-150160890 AGACTCTCCCAGAAAACACCTGG - Intergenic