ID: 926431732

View in Genome Browser
Species Human (GRCh38)
Location 2:12793919-12793941
Sequence CAGACTATTCTTGAGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926431727_926431732 1 Left 926431727 2:12793895-12793917 CCCTCCACTTAACCGACAATATA No data
Right 926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG No data
926431729_926431732 -3 Left 926431729 2:12793899-12793921 CCACTTAACCGACAATATAGCAG No data
Right 926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG No data
926431728_926431732 0 Left 926431728 2:12793896-12793918 CCTCCACTTAACCGACAATATAG No data
Right 926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG No data
926431726_926431732 14 Left 926431726 2:12793882-12793904 CCAATACTTGAGTCCCTCCACTT No data
Right 926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926431732 Original CRISPR CAGACTATTCTTGAGTAGGA TGG Intergenic
No off target data available for this crispr