ID: 926431732 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:12793919-12793941 |
Sequence | CAGACTATTCTTGAGTAGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
926431727_926431732 | 1 | Left | 926431727 | 2:12793895-12793917 | CCCTCCACTTAACCGACAATATA | No data | ||
Right | 926431732 | 2:12793919-12793941 | CAGACTATTCTTGAGTAGGATGG | No data | ||||
926431729_926431732 | -3 | Left | 926431729 | 2:12793899-12793921 | CCACTTAACCGACAATATAGCAG | No data | ||
Right | 926431732 | 2:12793919-12793941 | CAGACTATTCTTGAGTAGGATGG | No data | ||||
926431728_926431732 | 0 | Left | 926431728 | 2:12793896-12793918 | CCTCCACTTAACCGACAATATAG | No data | ||
Right | 926431732 | 2:12793919-12793941 | CAGACTATTCTTGAGTAGGATGG | No data | ||||
926431726_926431732 | 14 | Left | 926431726 | 2:12793882-12793904 | CCAATACTTGAGTCCCTCCACTT | No data | ||
Right | 926431732 | 2:12793919-12793941 | CAGACTATTCTTGAGTAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
926431732 | Original CRISPR | CAGACTATTCTTGAGTAGGA TGG | Intergenic | ||
No off target data available for this crispr |