ID: 926431988

View in Genome Browser
Species Human (GRCh38)
Location 2:12796778-12796800
Sequence AGACAGCGCCAAGAAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926431985_926431988 7 Left 926431985 2:12796748-12796770 CCTAACAAAGGGGTCATTATTCT No data
Right 926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926431988 Original CRISPR AGACAGCGCCAAGAAGGTCC TGG Intergenic
No off target data available for this crispr