ID: 926434548

View in Genome Browser
Species Human (GRCh38)
Location 2:12824697-12824719
Sequence CAGGAGAGACACTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926434548_926434551 -9 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434551 2:12824711-12824733 TCTCTCCTGCTTCCTTCTTTTGG No data
926434548_926434553 -7 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434553 2:12824713-12824735 TCTCCTGCTTCCTTCTTTTGGGG No data
926434548_926434558 23 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434558 2:12824743-12824765 GCTCAGCTTTGAAAGCCTTTTGG No data
926434548_926434556 1 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434556 2:12824721-12824743 TTCCTTCTTTTGGGGGATTCTGG No data
926434548_926434552 -8 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434552 2:12824712-12824734 CTCTCCTGCTTCCTTCTTTTGGG No data
926434548_926434554 -6 Left 926434548 2:12824697-12824719 CCCTCCTCAAAGTGTCTCTCCTG No data
Right 926434554 2:12824714-12824736 CTCCTGCTTCCTTCTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926434548 Original CRISPR CAGGAGAGACACTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr