ID: 926438730

View in Genome Browser
Species Human (GRCh38)
Location 2:12864186-12864208
Sequence CTTTCTATGCAGCAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926438723_926438730 26 Left 926438723 2:12864137-12864159 CCCAAATAAAGCCTTCTTCTCTG No data
Right 926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG No data
926438726_926438730 15 Left 926438726 2:12864148-12864170 CCTTCTTCTCTGGCAATACTCAG No data
Right 926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG No data
926438724_926438730 25 Left 926438724 2:12864138-12864160 CCAAATAAAGCCTTCTTCTCTGG No data
Right 926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926438730 Original CRISPR CTTTCTATGCAGCAAGTGGG AGG Intergenic
No off target data available for this crispr