ID: 926439755

View in Genome Browser
Species Human (GRCh38)
Location 2:12875459-12875481
Sequence GAGAATGAGGAGGTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926439744_926439755 15 Left 926439744 2:12875421-12875443 CCAAAGGGGAGCGCCAGCAGGAG No data
Right 926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG No data
926439748_926439755 2 Left 926439748 2:12875434-12875456 CCAGCAGGAGAGTAGAGGGAGGG No data
Right 926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926439755 Original CRISPR GAGAATGAGGAGGTGGAGGC TGG Intergenic
No off target data available for this crispr