ID: 926441757

View in Genome Browser
Species Human (GRCh38)
Location 2:12896205-12896227
Sequence TTACCTAGCTGGTTGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926441757_926441763 13 Left 926441757 2:12896205-12896227 CCCTGTACCAACCAGCTAGGTAA No data
Right 926441763 2:12896241-12896263 TCTTGACATTGCTGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926441757 Original CRISPR TTACCTAGCTGGTTGGTACA GGG (reversed) Intergenic