ID: 926441839

View in Genome Browser
Species Human (GRCh38)
Location 2:12897260-12897282
Sequence CAGAGTTAAAATTATTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926441835_926441839 24 Left 926441835 2:12897213-12897235 CCAATGAATACTGGATATGGACA No data
Right 926441839 2:12897260-12897282 CAGAGTTAAAATTATTAGGTAGG No data
926441837_926441839 -4 Left 926441837 2:12897241-12897263 CCACTGGAGACACTTTTTGCAGA No data
Right 926441839 2:12897260-12897282 CAGAGTTAAAATTATTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926441839 Original CRISPR CAGAGTTAAAATTATTAGGT AGG Intergenic
No off target data available for this crispr