ID: 926445697

View in Genome Browser
Species Human (GRCh38)
Location 2:12939501-12939523
Sequence TAAACATGGTAGGCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926445694_926445697 19 Left 926445694 2:12939459-12939481 CCATCACAATTCAGTTGTTTCTT No data
Right 926445697 2:12939501-12939523 TAAACATGGTAGGCTGCTTCTGG No data
926445693_926445697 22 Left 926445693 2:12939456-12939478 CCTCCATCACAATTCAGTTGTTT No data
Right 926445697 2:12939501-12939523 TAAACATGGTAGGCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926445697 Original CRISPR TAAACATGGTAGGCTGCTTC TGG Intergenic
No off target data available for this crispr