ID: 926447199

View in Genome Browser
Species Human (GRCh38)
Location 2:12957438-12957460
Sequence CTTTTGTTCTGTAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926447191_926447199 27 Left 926447191 2:12957388-12957410 CCAGCGCCTTGAAGACAATGGTG No data
Right 926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG No data
926447195_926447199 -4 Left 926447195 2:12957419-12957441 CCTTCCTGAAACAGTAAGGCTTT No data
Right 926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG No data
926447196_926447199 -8 Left 926447196 2:12957423-12957445 CCTGAAACAGTAAGGCTTTTGTT No data
Right 926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG No data
926447193_926447199 1 Left 926447193 2:12957414-12957436 CCTGTCCTTCCTGAAACAGTAAG No data
Right 926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG No data
926447192_926447199 21 Left 926447192 2:12957394-12957416 CCTTGAAGACAATGGTGTTTCCT No data
Right 926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926447199 Original CRISPR CTTTTGTTCTGTAGGGAAGA TGG Intergenic
No off target data available for this crispr